ID: 1064410005

View in Genome Browser
Species Human (GRCh38)
Location 10:15097005-15097027
Sequence TAGGCTGGCCTCCGAACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064409996_1064410005 13 Left 1064409996 10:15096969-15096991 CCCGGAGAGAGCGAGCCCTCGGG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1064410005 10:15097005-15097027 TAGGCTGGCCTCCGAACAACTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1064409998_1064410005 12 Left 1064409998 10:15096970-15096992 CCGGAGAGAGCGAGCCCTCGGGA 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1064410005 10:15097005-15097027 TAGGCTGGCCTCCGAACAACTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1064410001_1064410005 -3 Left 1064410001 10:15096985-15097007 CCTCGGGATACCATTGGCTATAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1064410005 10:15097005-15097027 TAGGCTGGCCTCCGAACAACTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1064410000_1064410005 -2 Left 1064410000 10:15096984-15097006 CCCTCGGGATACCATTGGCTATA 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1064410005 10:15097005-15097027 TAGGCTGGCCTCCGAACAACTGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064410005 Original CRISPR TAGGCTGGCCTCCGAACAAC TGG Intronic
901543370 1:9936728-9936750 CAGGCTGGTCTCGGAACATCTGG + Intronic
902476775 1:16692605-16692627 TGGGCCGGCCCCCGAAGAACAGG - Intergenic
906401323 1:45506954-45506976 CAGGCTGGTCTCCGAACTCCTGG - Intronic
906875932 1:49539416-49539438 AAGGCTGGCTCCCGAACTACTGG - Intronic
907370850 1:54002501-54002523 AAGGCTGTCCTCTGAACACCAGG - Intergenic
909096689 1:71296604-71296626 AAGGCAAGCCTCAGAACAACTGG + Intergenic
913218853 1:116643532-116643554 CAGGCTGGCCTCAGATCACCAGG - Intronic
921100877 1:211928592-211928614 TAGGCTGGGCTCATTACAACAGG + Intergenic
924592965 1:245421052-245421074 TAGGCTGGCCACCCAACAATGGG + Intronic
1062818754 10:518692-518714 TTGACTGGCCTCTAAACAACAGG - Intronic
1064410005 10:15097005-15097027 TAGGCTGGCCTCCGAACAACTGG + Intronic
1067317147 10:45179839-45179861 TAGGCCGGCCTCCAAAAAACCGG - Intergenic
1067317486 10:45181646-45181668 TAGGCCAGCCTCCAAAAAACCGG - Intergenic
1071472433 10:85993183-85993205 TTTGCTGGCCTCAGAACAGCAGG + Intronic
1071682644 10:87721936-87721958 TAGACTGGAGTCCAAACAACAGG + Intronic
1075116170 10:119628834-119628856 GAGGCTGGCCTCTTAACCACAGG - Intergenic
1077092534 11:786232-786254 TACGCTGGGCTCAGATCAACGGG + Intergenic
1078533328 11:12153797-12153819 TAGGCTGGCCTCCTAGAAATTGG + Intronic
1079217751 11:18528880-18528902 CAGGCTGGCCTCAGAACTCCTGG + Intergenic
1081550562 11:44107911-44107933 TCGGCTGGCAGCCTAACAACCGG - Exonic
1085366157 11:75947071-75947093 TAGGGTGGCCTCAAAAGAACAGG - Intronic
1089727224 11:120492966-120492988 CAGGCTGGCCTCCCAACTCCTGG + Intergenic
1100511561 12:95279805-95279827 CAGGCTGGTCTCCCAACTACTGG + Intronic
1100590924 12:96028399-96028421 AACACTGGCCTCTGAACAACTGG + Intronic
1105217005 13:18293730-18293752 AAGGCTGGCCCCTGAACAGCAGG + Intergenic
1107210790 13:37852089-37852111 TAGGCTGGACTCAGAACCAGAGG + Intronic
1126479014 15:49097231-49097253 TAGGCTGGTTTCCAAACACCTGG - Intergenic
1132949593 16:2553548-2553570 CAGGCTGGTCTCCCAACACCTGG + Intronic
1132964755 16:2646619-2646641 CAGGCTGGTCTCCCAACACCTGG - Intergenic
1133226882 16:4345005-4345027 TAGGCTGGCCTGGGAAAGACTGG + Intronic
1142793874 17:2291660-2291682 CAGGCTGGCCTCAAAACACCTGG - Intronic
1146554349 17:33810969-33810991 TATCCTGGCCTCAGAACAGCCGG + Intronic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151593339 17:75061433-75061455 CAGGCTGGTCTCCGAACTCCAGG - Intronic
1151747261 17:76018239-76018261 TAGGCTGGCCTCAGAGCTGCAGG - Exonic
1157576982 18:48750173-48750195 TAGGGTGGCCTCCCACCTACAGG - Intronic
1158864819 18:61628220-61628242 TAGGATGACATCAGAACAACAGG - Intergenic
1160687724 19:444495-444517 TAGGCTGGTGTCCCCACAACGGG - Intronic
1167500929 19:49847387-49847409 CAGGCTGGTCTCCTGACAACAGG + Intergenic
1202710790 1_KI270714v1_random:18429-18451 TGGGCCGGCCCCCGAAGAACAGG - Intergenic
929525969 2:42703171-42703193 CAGGCTGGTCTCCGAACTCCTGG + Intronic
930542356 2:52722524-52722546 TCTGCTGGGCTCCGAACAAGAGG - Intergenic
931571638 2:63674991-63675013 TAGGCTGGCATAAGAACAAGAGG - Intronic
938279008 2:130051619-130051641 TAGACTAGCCTCCCAACAGCAGG + Intergenic
938329991 2:130442495-130442517 TAGACTAGCCTCCCAACAGCAGG + Intergenic
938359954 2:130679008-130679030 TAGACTAGCCTCCCAACAGCAGG - Intergenic
938419414 2:131132507-131132529 TAGGCTGGCCTTGGAACTCCTGG + Intronic
938436362 2:131285729-131285751 TAGACTAGCCTCCCAACAGCAGG - Intronic
946477800 2:220025384-220025406 GAGCCTGGCCTCCAAACACCTGG - Intergenic
1172663439 20:36583069-36583091 CAGGCTGGCCTCAAAACACCTGG - Intronic
1180820155 22:18821594-18821616 CAGGCTGGCCTCAGATCACCAGG - Intergenic
1181119559 22:20656877-20656899 TAAGCTGGGCACCGAACATCAGG + Intergenic
1181206378 22:21256066-21256088 CAGGCTGGCCTCAGATCACCAGG - Intergenic
1203220542 22_KI270731v1_random:39357-39379 CAGGCTGGCCTCAGATCACCAGG + Intergenic
1203270282 22_KI270734v1_random:47465-47487 CAGGCTGGCCTCAGATCACCAGG - Intergenic
949955842 3:9268017-9268039 AAGGATGGCCTCAGACCAACAGG + Intronic
953992129 3:47492146-47492168 CAGGCTGGCCTCCAAACTCCTGG + Intergenic
954453344 3:50583505-50583527 TAGGCTGTCATCAGAACAAAGGG + Exonic
958945252 3:100354866-100354888 GAGTCTGGCCTCAGAACAATGGG - Intronic
961622117 3:128232393-128232415 AAGACTGGCCTCCGCACACCCGG + Intronic
962757877 3:138481329-138481351 CAGGCTGGCCTTTGAACACCTGG - Intronic
966760149 3:183410657-183410679 CAGGCTGGCCTGGGAAAAACAGG - Intronic
972521366 4:39860252-39860274 CAGGCTGGTCTCCCAACTACTGG - Intronic
974931731 4:68367720-68367742 CAGGCTGGTCTCAGAACACCTGG - Intergenic
979404019 4:120286880-120286902 TGGTCTGGCCTCTGAAAAACTGG - Intergenic
987831850 5:23105076-23105098 TAGGCTGGTCTTGGGACAACAGG + Intergenic
990481261 5:56213685-56213707 TAGGCTGGCTTACGAGCAAAGGG + Intronic
994041697 5:95266126-95266148 TAGACTGGCCTCCTAACAGTAGG - Intronic
1002003333 5:176211910-176211932 TAGGCTGGTCTCCGAACTCCTGG - Intergenic
1006423201 6:33948388-33948410 TAGGCTGGACTGGGAGCAACAGG - Intergenic
1006728464 6:36217252-36217274 TAGGCTGGGCTCTGAAACACAGG - Intronic
1007349524 6:41258762-41258784 TTGGTTGGCCTCCAAACAAGAGG - Intergenic
1007483492 6:42165150-42165172 TTGGCTGGCCTCAGACCATCTGG + Intronic
1022392945 7:29959477-29959499 TAGGCTGTCCTCCCAATACCTGG + Intronic
1026563615 7:71471285-71471307 CAGGCTGGTCTCCGAACTGCTGG + Intronic
1029109675 7:98206544-98206566 CAGCCTGGCCTCCGAAAACCAGG - Exonic
1029271263 7:99378280-99378302 CAGGCTGGTCTCCGAACTCCTGG + Intronic
1032069297 7:128794013-128794035 TAGGCTGGCCTCTGAGTAGCAGG - Intronic
1032214655 7:129948602-129948624 CAGGCTGGCCTCCCAACTCCTGG - Intronic
1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG + Intergenic
1040485654 8:47869134-47869156 TGGGCTGGGCTCAGAACAAGTGG + Intronic
1044944084 8:97374961-97374983 TAGGCTGGCCACCCAAGAGCAGG + Intergenic
1050508135 9:6368681-6368703 TATGCTGGGCTCGGAACCACTGG + Intergenic
1062029396 9:134355396-134355418 TATGCTGGTCTCCGAAAAGCTGG + Intronic