ID: 1064410051

View in Genome Browser
Species Human (GRCh38)
Location 10:15097194-15097216
Sequence TCCGGGTCGCGCGACGCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 16}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064410042_1064410051 25 Left 1064410042 10:15097146-15097168 CCCGGGGCCTAAACTCGAGTCTA 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1064410051 10:15097194-15097216 TCCGGGTCGCGCGACGCTGTGGG 0: 1
1: 0
2: 1
3: 0
4: 16
1064410040_1064410051 29 Left 1064410040 10:15097142-15097164 CCACCCCGGGGCCTAAACTCGAG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1064410051 10:15097194-15097216 TCCGGGTCGCGCGACGCTGTGGG 0: 1
1: 0
2: 1
3: 0
4: 16
1064410049_1064410051 -8 Left 1064410049 10:15097179-15097201 CCTCGTTGTGTCGTTTCCGGGTC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1064410051 10:15097194-15097216 TCCGGGTCGCGCGACGCTGTGGG 0: 1
1: 0
2: 1
3: 0
4: 16
1064410044_1064410051 18 Left 1064410044 10:15097153-15097175 CCTAAACTCGAGTCTAAAAGATT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1064410051 10:15097194-15097216 TCCGGGTCGCGCGACGCTGTGGG 0: 1
1: 0
2: 1
3: 0
4: 16
1064410043_1064410051 24 Left 1064410043 10:15097147-15097169 CCGGGGCCTAAACTCGAGTCTAA 0: 1
1: 0
2: 0
3: 7
4: 54
Right 1064410051 10:15097194-15097216 TCCGGGTCGCGCGACGCTGTGGG 0: 1
1: 0
2: 1
3: 0
4: 16
1064410041_1064410051 26 Left 1064410041 10:15097145-15097167 CCCCGGGGCCTAAACTCGAGTCT 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1064410051 10:15097194-15097216 TCCGGGTCGCGCGACGCTGTGGG 0: 1
1: 0
2: 1
3: 0
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064410051 Original CRISPR TCCGGGTCGCGCGACGCTGT GGG Exonic