ID: 1064415372

View in Genome Browser
Species Human (GRCh38)
Location 10:15144868-15144890
Sequence TGTAATGGCTAGGGTATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064415372_1064415378 24 Left 1064415372 10:15144868-15144890 CCCTGTATACCCTAGCCATTACA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1064415378 10:15144915-15144937 ATGAAAACTTATGTCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064415372 Original CRISPR TGTAATGGCTAGGGTATACA GGG (reversed) Intronic
905490438 1:38339501-38339523 TGAAATGGCTATGCTATATAGGG + Intergenic
913203388 1:116514081-116514103 TGTATTGACTTGGGTTTACATGG + Intergenic
917656626 1:177132633-177132655 GGTAATGGCTAGGATCTACCTGG + Intronic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1064415372 10:15144868-15144890 TGTAATGGCTAGGGTATACAGGG - Intronic
1069216242 10:65824851-65824873 TATAATAACTGGGGTATACATGG + Intergenic
1071758271 10:88570875-88570897 TATAGTTGCTAGGCTATACAGGG - Intronic
1072004789 10:91234496-91234518 AGAAATGGCTAGGGTAGAAATGG + Intronic
1073907413 10:108298961-108298983 TGTAATGGGTTGCATATACAGGG - Intergenic
1075869921 10:125764340-125764362 TGTAATGGCTACAGTGCACAAGG + Intergenic
1082969853 11:59008594-59008616 GGAAATGGTTAGGGTATAAATGG + Intronic
1083522280 11:63325694-63325716 TCTAATATCTAGGATATACAAGG + Intronic
1086958804 11:92961281-92961303 TTAAATGTCTTGGGTATACAGGG - Intergenic
1087279696 11:96196707-96196729 TGTAATGTCTAGGGTAAATAAGG + Intronic
1087844446 11:102956397-102956419 TGTAATGGCTAGCACAAACAGGG + Intergenic
1088511228 11:110577746-110577768 TGTAATGGTTAGCGCAAACAGGG + Exonic
1093729629 12:22552691-22552713 TGTAATCGCCAGGGTTTACTAGG + Intergenic
1096621275 12:52867195-52867217 TGTAGGGACAAGGGTATACAGGG + Intergenic
1100034862 12:90237834-90237856 TGTAATGGATAGGGGATGGATGG + Intergenic
1100915783 12:99420168-99420190 TGTAATGGAAAGTGTATTCATGG - Intronic
1108484916 13:50913787-50913809 TGAAATGTCTAAGGTAGACAGGG - Intronic
1109115817 13:58382651-58382673 TGTCATTTCTAGGGTATCCAGGG - Intergenic
1109769133 13:66947142-66947164 TGCAATGGCTGGAATATACAAGG + Intronic
1110269086 13:73572986-73573008 AGTAGTGGCTAGGGGATAGAAGG - Intergenic
1116767974 14:49095321-49095343 TGTAGGGGCTAGGGTTTAGAAGG + Intergenic
1121906058 14:97746537-97746559 TCTTATGGCTAGAGTTTACATGG + Intergenic
1131685652 15:94764896-94764918 TGTAATGTCAAAGGTATACTGGG - Intergenic
1138306568 16:55982106-55982128 GGTGATGGCTAAAGTATACAAGG - Intergenic
1140608851 16:76573754-76573776 TGTAATGGCCAGTCTATTCATGG - Intronic
1141562404 16:84878248-84878270 TGTTTTGGCCAAGGTATACAGGG + Intronic
1143530132 17:7497897-7497919 TGGAATGGCTAGGGAAGACATGG + Intronic
1144999163 17:19291391-19291413 TGGAATGGCAAGGCTATCCACGG + Intronic
1151499597 17:74480398-74480420 TGAAAGGGTTAGGGTGTACAGGG + Intronic
1157874127 18:51255810-51255832 AGTAATTGCTAGGCTATGCACGG - Intergenic
1164371296 19:27646646-27646668 TATAATGCCTAGGGTCAACAAGG + Intergenic
927096511 2:19751357-19751379 TGCCATGGCTAGGGTATGTATGG - Intergenic
928081803 2:28318717-28318739 TCTAATGGCTCTGGTATGCATGG + Intronic
929704786 2:44198850-44198872 TGTAATTACTAGGGAATAAAGGG + Intronic
930192223 2:48471744-48471766 TGTAAGGGCTAGAGTAGATAAGG - Intronic
934814017 2:97309034-97309056 TGTAATTTCCAGGGTCTACAAGG + Intergenic
934823678 2:97399448-97399470 TGTAATTTCCAGGGTCTACAAGG - Intergenic
939099652 2:137881051-137881073 AGTTCTGGCTAGGGTTTACATGG - Intergenic
939164049 2:138621239-138621261 TATCAGGGCTAGGGTATGCAGGG + Intergenic
940147542 2:150562774-150562796 TCTAATGGATAGGATAGACATGG - Intergenic
944386326 2:199169121-199169143 TGAAATGGCTAGGAAATAAAAGG + Intergenic
947149742 2:227103187-227103209 TGTAATTTTTAGGGTATAAAAGG - Exonic
1169715185 20:8608030-8608052 TTTAATGACTAGAATATACAGGG + Intronic
1176979867 21:15369111-15369133 GGTATTGGCTAAGGAATACAGGG - Intergenic
1178322342 21:31614962-31614984 AGGAATTGCTTGGGTATACAGGG + Intergenic
951676787 3:25250318-25250340 GGCACTGGCTAGGGTAGACAGGG + Intronic
953696246 3:45161979-45162001 TGAGATGGATAGGGTATTCATGG + Intergenic
959896481 3:111612387-111612409 TGTAATTGCTAGGGAAAAAATGG - Intronic
963939998 3:151087754-151087776 TTCAATGGCTAGGGTAACCATGG + Intronic
965288324 3:166844837-166844859 TGCAATGGCAAGGATATACAAGG - Intergenic
966216257 3:177506194-177506216 TGTAATGGCTACAGGATGCAGGG - Intergenic
967581204 3:191157052-191157074 TGTAATGCCTACTGTATGCATGG - Intergenic
970687884 4:18589128-18589150 AGAAATGGCTAGGGTATATTTGG + Intergenic
972649336 4:41001301-41001323 TGTGATGGTTAAGGTATACAAGG - Intronic
973947267 4:55971597-55971619 TGTTTTGGCTAGTTTATACAGGG + Intronic
985007826 4:185551754-185551776 TGTAATGGCTAGTATATAGCAGG - Intergenic
990374715 5:55157879-55157901 TATAATGACTTGGGTTTACACGG + Intronic
993602873 5:89950378-89950400 TGAAATGGTGAGGGTAAACAAGG + Intergenic
994926812 5:106126561-106126583 AGTAATGAATAGGGTAGACAAGG + Intergenic
997775937 5:136605064-136605086 TGTAATGGGTATTGTATTCATGG + Intergenic
1007907253 6:45474290-45474312 TATAATGGCTAGGGAATATTTGG + Intronic
1011576450 6:88805878-88805900 TGTAATGCCTAGAGTATAAAAGG - Intronic
1013824956 6:114200394-114200416 TGTAAATGCTCGGTTATACAAGG + Intronic
1016981742 6:149860889-149860911 TATAATCCCTAGTGTATACAAGG - Intronic
1030799689 7:113834347-113834369 TTAAATGGCTTGGTTATACATGG + Intergenic
1044052855 8:87530614-87530636 TGTGATGGCAAGGATATAAAAGG + Intronic
1044892208 8:96849515-96849537 TATATTGGCTTGGGTTTACAGGG - Intronic
1054729189 9:68683785-68683807 TGCAATGGGGAGGGTTTACACGG + Intergenic
1054941403 9:70746612-70746634 TGCAATTGGTAGGGGATACAGGG + Intronic
1056039555 9:82648696-82648718 TGTAATGGATAGGGTATCACTGG - Intergenic
1056641320 9:88373434-88373456 GGTAATGGCTAAGGAGTACATGG - Intergenic
1191242485 X:58200406-58200428 TAAAATGCCTAGGGTATGCATGG - Intergenic
1199137843 X:144274047-144274069 GGTAATGAGTAGGGTAAACATGG + Intergenic
1200362591 X:155625715-155625737 TGTCATGGCTAAGGGATGCAGGG - Intronic