ID: 1064417878

View in Genome Browser
Species Human (GRCh38)
Location 10:15166691-15166713
Sequence CAAAATTTAGAGATGCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064417878 Original CRISPR CAAAATTTAGAGATGCCCCA TGG (reversed) Intronic
900487425 1:2929979-2930001 CAAGATGTAGTTATGCCCCAAGG + Intergenic
902461899 1:16583875-16583897 CAAAATTTAGAGATGAAGAAAGG + Intronic
903317604 1:22520798-22520820 CAAATCTTATAGATGCCACAAGG - Intronic
904332825 1:29774909-29774931 CCAGATTCAGAGATGACCCAGGG - Intergenic
912378592 1:109233519-109233541 CAAAATTTAGAAATGGCAGAGGG + Intronic
916372215 1:164111107-164111129 TAAAATTTGGAGATGACCCTAGG + Intergenic
917761832 1:178169287-178169309 CATAACTTAGAGAAACCCCAGGG + Intronic
919730778 1:200912325-200912347 CAAAATTAGGAGGTGCCCCAGGG - Intronic
921684074 1:218070148-218070170 CAACATTGAAATATGCCCCAAGG + Intergenic
922516256 1:226210436-226210458 CAAATTTTAAAAATGCCCCCAGG + Intergenic
1063734401 10:8736085-8736107 CAAACTTTTGACATGCCCGAAGG + Intergenic
1064417878 10:15166691-15166713 CAAAATTTAGAGATGCCCCATGG - Intronic
1064719077 10:18209932-18209954 CAAAATCTAGACATCCACCAAGG - Intronic
1067149093 10:43714937-43714959 CAAACCTTAGAGATGGCACAGGG + Intergenic
1067382357 10:45786706-45786728 AAAAGTTTATAGATGCCACAGGG - Intronic
1067890057 10:50127254-50127276 AAAAGTTTATAGATGCCACAGGG - Intronic
1069315041 10:67088118-67088140 AAAAATTGAGAGATGCCAAATGG + Intronic
1069617408 10:69814990-69815012 CAAAATTGATAGATGCTCCGTGG + Intronic
1071032996 10:81206593-81206615 TAATACTAAGAGATGCCCCAAGG - Intergenic
1074739212 10:116468333-116468355 CACAATTTAGATATAACCCAAGG + Intronic
1075523347 10:123159365-123159387 AAAAATGCAGAGAGGCCCCATGG - Intronic
1082920441 11:58486672-58486694 TAATATTAAGAGATGCCCAAAGG - Intergenic
1087004847 11:93459744-93459766 CATAATTGAGAGATTCGCCAAGG + Intergenic
1087021396 11:93606977-93606999 TAACATTAAGAGATGCCCTAAGG + Intergenic
1087530999 11:99382058-99382080 CAAAATTTACAAATGCCTCAGGG + Intronic
1088007771 11:104962959-104962981 CAAGATTTAGAATTTCCCCAAGG - Intronic
1088019694 11:105104501-105104523 CAAGATTTAGAATTTCCCCAAGG - Intergenic
1088060659 11:105645294-105645316 CAAAATTCAGATATGCTCCTTGG + Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089861577 11:121594849-121594871 CAAGATTCAGAGTTCCCCCATGG - Intronic
1093101535 12:15035312-15035334 CAAGATTTAGAATTTCCCCAAGG + Intergenic
1094102778 12:26781059-26781081 TAATACTAAGAGATGCCCCAAGG - Intronic
1094813967 12:34166242-34166264 CAAAATCTAGGAGTGCCCCAAGG - Intergenic
1096023414 12:48340870-48340892 CAGTATTAGGAGATGCCCCAGGG - Exonic
1096925667 12:55142549-55142571 TAAAATTAAGAAATGCCCTATGG + Intergenic
1096925688 12:55142930-55142952 TAAAATTAAGAAATGCCCTATGG - Intergenic
1098954744 12:76677831-76677853 TTAAATTTAGAGATGCTCCTTGG + Intergenic
1100194970 12:92235210-92235232 CAAAAATAAGAGTTGCCCCATGG - Intergenic
1100417301 12:94391167-94391189 CATAATTTTCAGATGCACCAAGG + Intronic
1106856122 13:33854889-33854911 CATAGTTTAGATATACCCCAGGG + Intronic
1108721296 13:53135561-53135583 CTAAATGTTGACATGCCCCAGGG + Intergenic
1111855701 13:93634371-93634393 TAAAATTTAGAAATGGCCAAGGG + Intronic
1117843133 14:59881433-59881455 CAAAATTTAGCCAGGGCCCATGG - Intergenic
1120020730 14:79526936-79526958 CAGAACCCAGAGATGCCCCAAGG + Intronic
1122710760 14:103655833-103655855 CAAAATTCAGAGAGGCCCTGAGG - Intronic
1125525410 15:40370958-40370980 CGTAATTGAGAGATGCTCCAAGG - Exonic
1126147301 15:45487862-45487884 GAACATTTAGAGATGGCACAAGG - Intronic
1127236629 15:57059852-57059874 CAAAACCTAGAGATGCCCATAGG + Intronic
1129769679 15:78194932-78194954 CAAAGTTTAGGGATGCAGCAAGG + Intronic
1130321402 15:82845588-82845610 CAAAATCTAGTGATGTCTCAAGG + Intronic
1132050867 15:98606725-98606747 CAGGATTTAGGGATGCCCAAAGG + Intergenic
1137543454 16:49380487-49380509 CAAGATTTACAGAAGCTCCAGGG - Intronic
1145043462 17:19594067-19594089 CAAAATATAAAGATGCCAAATGG - Intergenic
1149159345 17:53672134-53672156 CACAAAGTAGAGAAGCCCCAAGG + Intergenic
1153206581 18:2709738-2709760 CAAAATTTAAAAATGGCCAAAGG - Intronic
1154511354 18:15106037-15106059 TGAAATCTAGACATGCCCCAAGG + Intergenic
1157734097 18:50031104-50031126 CAAAATTTAGAGAGGCGGTAGGG + Intronic
1160925156 19:1540780-1540802 GAGAATTTGGAGATGCCCCCAGG + Intergenic
1161778565 19:6277221-6277243 CAAATTTGAGAGAGGCCCAAGGG - Intronic
1167875158 19:52406068-52406090 CACAATTCAGAGATCCACCAGGG - Intronic
926876260 2:17482962-17482984 TAAAATTTAGAGAAGCACAAGGG - Intergenic
927332150 2:21878219-21878241 GAAAATATAGAGAAGCCACATGG - Intergenic
931878018 2:66535212-66535234 CAAAATTTAGAGTGGACACATGG - Intronic
932949924 2:76281063-76281085 CAATATTTAGAAAAGCTCCAAGG + Intergenic
933201332 2:79453351-79453373 AAAAATTTAAATATGCCCCCTGG + Intronic
937095671 2:119233878-119233900 CAAAAGTTGGAGCTGGCCCATGG + Intronic
937147104 2:119656844-119656866 CCAAATCTAGTGATGCCCCAGGG - Intronic
938506567 2:131890499-131890521 TGAAATCTAGACATGCCCCAAGG + Intergenic
939292509 2:140214313-140214335 CAAGATTTAGAGATCCACCCCGG + Intergenic
945160001 2:206880059-206880081 CAAAATGAAGAAATGGCCCATGG - Intergenic
948324283 2:237100335-237100357 CAAATTTTAGAGATATCCAATGG - Exonic
1169789478 20:9393903-9393925 CAGAATTTGGAGAGGGCCCAAGG + Intronic
1170385625 20:15813211-15813233 AAAAATTTAGAAATGTCCAATGG - Intronic
1172001327 20:31780014-31780036 AAAAATTTAGAGATCCTCAAAGG - Intronic
1173756450 20:45520958-45520980 TAATATTAAGAGTTGCCCCAAGG + Intergenic
1175046387 20:56109802-56109824 CAAAGTTGAGAGATACCCCAAGG + Intergenic
1176940813 21:14922814-14922836 AAAAATAAAGAGATGCCCCATGG - Intergenic
1182926081 22:34126568-34126590 ACAAATCTAGAGATGCCCCAGGG - Intergenic
1184304035 22:43582927-43582949 AAAGATTCATAGATGCCCCAAGG + Intronic
950022944 3:9801464-9801486 CGTCATTAAGAGATGCCCCAAGG + Intronic
951059508 3:18188716-18188738 CACCATTCTGAGATGCCCCAGGG + Intronic
951529331 3:23684001-23684023 CGTCATTTAGAGAAGCCCCAAGG - Intergenic
953547732 3:43876020-43876042 CCAAAGTAAGAGATGCCTCAGGG - Intergenic
953826662 3:46258497-46258519 CACAGTTTAGATATGTCCCAAGG - Intronic
954120158 3:48493275-48493297 CAAAAATTAGCCATGCACCATGG + Intronic
954584102 3:51719252-51719274 CAAACTCCAGAGATGCCCAAGGG - Intergenic
956357505 3:68410233-68410255 GAAACTAGAGAGATGCCCCATGG + Intronic
956389958 3:68760973-68760995 CAAAAAGTAGAGATGCCAAATGG + Intronic
961809218 3:129512393-129512415 TACACTTTAGAGATGCCCGAGGG - Exonic
962214951 3:133513170-133513192 TAATATTAAGAGATGGCCCAAGG - Intergenic
962325714 3:134430463-134430485 CAGATTTTTGAGATGCCACATGG + Intergenic
962510491 3:136095010-136095032 CAGAATCTGCAGATGCCCCAAGG + Intronic
964270179 3:154946846-154946868 CATAATTTTCAGATGCACCAAGG + Intergenic
964297894 3:155253686-155253708 TAATATTAAGAGATGCCCTAAGG - Intergenic
964336741 3:155662605-155662627 AAAAATTTAGAGATCCCACTGGG - Intronic
964866646 3:161269714-161269736 CAGAAATTGGAGATGCCCCTGGG + Intergenic
965334434 3:167418694-167418716 CACAATTTAGACATACCCCAAGG + Intergenic
965694888 3:171397935-171397957 AAAAATGTTGAGATTCCCCAAGG - Intronic
965830913 3:172788481-172788503 CAAAATTTACTCATGCCCCTTGG + Intronic
968341055 3:197956114-197956136 AAAAATTTAAAAATGACCCAGGG - Exonic
974113472 4:57552377-57552399 CAAAATTTAAATTTGCCTCATGG + Intergenic
974978253 4:68919051-68919073 CAAAATTTAAAAATGTTCCAAGG + Intergenic
978974284 4:114849689-114849711 CAAAATTAATAAATGCCCTAGGG + Intronic
979422006 4:120515945-120515967 CTAAATTTTGAAATGCCCCACGG + Intergenic
979789853 4:124765579-124765601 CAAGAGGTTGAGATGCCCCATGG - Intergenic
980070842 4:128241777-128241799 CAAAATGTCAAAATGCCCCAGGG + Intergenic
981583794 4:146277307-146277329 CAAAATTTAGAAAGTCCCCAGGG - Intronic
984899292 4:184570429-184570451 CAGAAGTGACAGATGCCCCAGGG - Intergenic
987938479 5:24501267-24501289 CACAATATAGAGATTCTCCAGGG + Intronic
988008418 5:25450005-25450027 TAAAATTTGGAGGTGCGCCAAGG - Intergenic
988233064 5:28505295-28505317 TAATACTAAGAGATGCCCCAAGG + Intergenic
988594768 5:32581542-32581564 CCGAGTTCAGAGATGCCCCAGGG - Intronic
989674613 5:43959065-43959087 CATAATTTAGATATACCACATGG + Intergenic
990721203 5:58698376-58698398 CAAAATTTTCAGATTCACCAAGG - Intronic
992798801 5:80277289-80277311 CAAGATTTGGAGATGCCCTGAGG + Intergenic
995325187 5:110881965-110881987 CAAAATTGAGAGATTGCCTATGG + Intergenic
998655830 5:144178869-144178891 TAAAATTTTGAGAGGCCCCTAGG + Intronic
999896394 5:156038661-156038683 CAAAATTTACAGAGGCAACATGG + Intronic
1002640493 5:180628459-180628481 AGAAATTTGGAGATGCCACAGGG - Intronic
1005413504 6:25576181-25576203 CAAAATTTAATGATGACCAATGG + Intronic
1006915257 6:37589797-37589819 CACAATTCAGAGAGGCCCAAAGG + Intergenic
1009859713 6:69311555-69311577 CAAAAGTTAAAGATGTCCTAGGG - Intronic
1010282364 6:74036425-74036447 CAAAGATTAGAGATGGTCCAAGG + Intergenic
1010367817 6:75072320-75072342 CAAAATATAGATCTGGCCCATGG + Intergenic
1012755576 6:103226512-103226534 CAAAATGTATAGATGCACAATGG + Intergenic
1015095201 6:129407822-129407844 TAATATTAAGAGATGCCCTATGG + Intronic
1017390620 6:153935083-153935105 GAAAATTTACATATGCACCATGG - Intergenic
1017452255 6:154565083-154565105 CAAAATTTAAAGAAGCCCATTGG - Intergenic
1017628624 6:156373967-156373989 GACAATTTTGAGATGACCCAAGG - Intergenic
1020333576 7:7043835-7043857 CATAATTGTGAGATTCCCCAAGG + Intergenic
1023232026 7:38042839-38042861 CAAAAGTTAGAAAGGCCACAAGG + Intergenic
1023680197 7:42677938-42677960 CCACATTTGGAGATGCTCCAGGG - Intergenic
1025858210 7:65302840-65302862 CAAAATTTAGGGTGGCCACAGGG + Intergenic
1027177122 7:75911659-75911681 CATAATTTAGAAATGCCTCTTGG + Intronic
1030943924 7:115692429-115692451 CCCAATTTAGAGATGTCCTATGG + Intergenic
1037956149 8:23061028-23061050 CACAGTTTAGATATACCCCACGG + Intronic
1038519988 8:28223291-28223313 CAAAATTTAAAGAAGCCTTAAGG - Intergenic
1038682758 8:29684409-29684431 GAATATTTGGAGATTCCCCAGGG - Intergenic
1040093720 8:43422406-43422428 CAAAATTTAGAGAGGAAGCAAGG + Intergenic
1040400039 8:47040979-47041001 CAAAATTTAGAGAGGAAGCAAGG - Intergenic
1042221974 8:66483215-66483237 CCAACTTCAGAGTTGCCCCATGG + Intronic
1043384404 8:79733651-79733673 CAAAATTTAGCCAGGCACCATGG + Intergenic
1043530583 8:81145776-81145798 CAATGTTTAGAGAAGCCTCATGG + Intergenic
1043539541 8:81243976-81243998 CAAAATCTGGATCTGCCCCAGGG - Intergenic
1044865870 8:96570653-96570675 CAAAATTGAGAAATGCTCTAAGG + Intronic
1045974807 8:108120349-108120371 CAGAAATTTGAGTTGCCCCAGGG - Intergenic
1050800035 9:9599310-9599332 CACAATTTACAGATGCCCACTGG + Intronic
1053348290 9:37394345-37394367 CAAAATTTAGCGAGGCCTGATGG - Intergenic
1053404028 9:37855296-37855318 CAAAAATTAGTGATGGCACAAGG + Intronic
1055690003 9:78819777-78819799 CAGCATTTATAGATGCCTCAGGG + Intergenic
1058255420 9:102756425-102756447 CAAAATCTAAAGGTGCCACAGGG - Intergenic
1058555352 9:106160790-106160812 CTAAATGTTGAGATGCCCAAGGG - Intergenic
1058628999 9:106966754-106966776 CAAATTTTAGAGGTGGCCAAGGG - Intronic
1058925284 9:109657111-109657133 TAAAGGTCAGAGATGCCCCAGGG + Intronic
1059797306 9:117712562-117712584 CAAAGTTTTGAGATGTCCAATGG - Exonic
1060907518 9:127320730-127320752 CAAATTTGAGAAAGGCCCCAGGG + Exonic
1062706914 9:137950691-137950713 TAAAATTTGGAAATGCCCAAGGG - Intronic
1186353468 X:8764560-8764582 CAAAATTTAGAGGTCTCCCAAGG - Intergenic
1186650039 X:11549482-11549504 CAGAATTTTTAGAAGCCCCAGGG + Intronic
1187524157 X:20038897-20038919 TAAAACTAAGAGATGCCCTAAGG - Intronic
1188478060 X:30607855-30607877 AAAAATTTAGGGCTGCCACAAGG + Intergenic
1190058624 X:47196771-47196793 CATAAATTAGAGATGATCCAGGG - Intronic
1190765935 X:53475707-53475729 TAATATTCAGAGATGCCCTAAGG - Intergenic
1191988129 X:67004069-67004091 TAATATTAAGAGATGCCCTAAGG + Intergenic
1194485345 X:94479084-94479106 TAATACTAAGAGATGCCCCAAGG - Intergenic
1194969781 X:100330642-100330664 CATAATTTAGAAAGGCCCTAAGG + Intronic
1195013402 X:100754955-100754977 TAATATTAAGAGATGCCCTAAGG + Intergenic
1198739043 X:139821106-139821128 CAAAATTTAGGGAATCCTCAGGG + Intronic
1199008708 X:142732741-142732763 AAAGATTAAGAGATGCCCTAGGG - Intergenic
1199565317 X:149209501-149209523 CAAAATTTTGAGCTTCCTCATGG - Intergenic
1201273528 Y:12278348-12278370 CAAAAGTACGAGATACCCCATGG + Intergenic
1201454767 Y:14157986-14158008 CAAAACCTAGAGAAGCCCAAAGG + Intergenic
1202262383 Y:22983357-22983379 TAAAATTTTGAGATCTCCCAGGG + Intronic
1202415373 Y:24617098-24617120 TAAAATTTTGAGATCTCCCAGGG + Intronic
1202455414 Y:25052988-25053010 TAAAATTTTGAGATCTCCCAGGG - Intronic