ID: 1064419263

View in Genome Browser
Species Human (GRCh38)
Location 10:15176592-15176614
Sequence TAGAACAAGCGGCAGTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064419259_1064419263 0 Left 1064419259 10:15176569-15176591 CCAAACCAGCCACTCGCAAAATC No data
Right 1064419263 10:15176592-15176614 TAGAACAAGCGGCAGTTCTCTGG No data
1064419258_1064419263 15 Left 1064419258 10:15176554-15176576 CCATCTGATCTACAGCCAAACCA No data
Right 1064419263 10:15176592-15176614 TAGAACAAGCGGCAGTTCTCTGG No data
1064419260_1064419263 -5 Left 1064419260 10:15176574-15176596 CCAGCCACTCGCAAAATCTAGAA No data
Right 1064419263 10:15176592-15176614 TAGAACAAGCGGCAGTTCTCTGG No data
1064419261_1064419263 -9 Left 1064419261 10:15176578-15176600 CCACTCGCAAAATCTAGAACAAG No data
Right 1064419263 10:15176592-15176614 TAGAACAAGCGGCAGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064419263 Original CRISPR TAGAACAAGCGGCAGTTCTC TGG Intergenic
No off target data available for this crispr