ID: 1064423901

View in Genome Browser
Species Human (GRCh38)
Location 10:15213498-15213520
Sequence GAAAAGGCCCTGATGGAGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064423901_1064423906 29 Left 1064423901 10:15213498-15213520 CCAAGCTCCATCAGGGCCTTTTC 0: 1
1: 0
2: 3
3: 25
4: 248
Right 1064423906 10:15213550-15213572 GAGCCAAAGCCGCGTCGTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 11
1064423901_1064423907 30 Left 1064423901 10:15213498-15213520 CCAAGCTCCATCAGGGCCTTTTC 0: 1
1: 0
2: 3
3: 25
4: 248
Right 1064423907 10:15213551-15213573 AGCCAAAGCCGCGTCGTTCAGGG 0: 1
1: 0
2: 0
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064423901 Original CRISPR GAAAAGGCCCTGATGGAGCT TGG (reversed) Exonic
902399566 1:16150625-16150647 GAGAAGGCCCTAGCGGAGCTGGG - Intronic
902693491 1:18125167-18125189 GCAAAGGCCCTGGGGCAGCTGGG - Intronic
902744810 1:18466627-18466649 GAGGTGGCCCTGATGGATCTTGG + Intergenic
902932416 1:19740854-19740876 GCCAAGTACCTGATGGAGCTCGG - Exonic
904292893 1:29499034-29499056 GAGCAGGCCCAGATGGAACTGGG - Intergenic
905252248 1:36657151-36657173 TAAAAGGCTGTGTTGGAGCTGGG - Intergenic
906516308 1:46440804-46440826 GAGAAGGCCCAGCTGGACCTGGG + Intergenic
907634972 1:56125188-56125210 GAATAGGCCCACATGGAGCAAGG + Intergenic
911982237 1:104581969-104581991 GAAAGGACCCTGATGAAGCTGGG - Intergenic
912066680 1:105753945-105753967 GGGAAGACCCTGATGAAGCTGGG + Intergenic
916722944 1:167498585-167498607 TAATGGGCCCAGATGGAGCTAGG - Intronic
917276214 1:173334653-173334675 GAGAAGACCCTGATGAAGCTGGG + Intergenic
917462376 1:175243561-175243583 GGGAGGGCCCTGATGAAGCTGGG + Intergenic
919230363 1:194765214-194765236 GGAAGGACCCTGATGAAGCTGGG - Intergenic
920624823 1:207586713-207586735 GAAAAGGCTATGATGGAGGCAGG - Intronic
921048078 1:211491423-211491445 GAAAGGAACCTGCTGGAGCTGGG + Intronic
921478002 1:215633295-215633317 GCCAAGGCCCTGATGGTGTTGGG + Intronic
924385671 1:243496405-243496427 GAAATGCCCCAGATGGAGGTAGG + Intronic
1064003899 10:11685096-11685118 GAGGAGCCCCTGATGGAGCCGGG - Intergenic
1064423901 10:15213498-15213520 GAAAAGGCCCTGATGGAGCTTGG - Exonic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067727921 10:48786650-48786672 GGAAAGGCCCTGGTAGAGCCTGG - Exonic
1068595417 10:58897976-58897998 GTAAAGGCCCAGATGGGGCAAGG + Intergenic
1069501457 10:68956576-68956598 AGAGAGGCCCTGTTGGAGCTCGG + Intronic
1069613431 10:69790796-69790818 CAAAAGGACCTGATGGGGTTAGG + Intergenic
1069742260 10:70692309-70692331 GAAATGGCCCTCCTGGAGCCGGG - Intronic
1070592273 10:77809656-77809678 AAAAAGTCCCAGCTGGAGCTTGG - Exonic
1070750208 10:78959642-78959664 GAGAAGGCTCTGATGGTGGTGGG + Intergenic
1072552804 10:96492234-96492256 AAAAAGGCCATGAGGGAGGTAGG + Intronic
1073662296 10:105489853-105489875 GAAGAGCCCCTGAAGGAGATAGG + Intergenic
1075258787 10:120945418-120945440 GTAAAGGCCAAGAAGGAGCTAGG - Intergenic
1076636167 10:131883692-131883714 GAGAAGGCTCTGAAGAAGCTGGG - Intergenic
1076675413 10:132145164-132145186 GAGAAGGCCCTGGCGGAGCAGGG + Exonic
1077400683 11:2355381-2355403 GGAAGGACCCTGATGAAGCTGGG + Intergenic
1077888572 11:6403370-6403392 GATGAGGCCCCAATGGAGCTGGG - Exonic
1077894178 11:6441473-6441495 GAAAGGCCCCTGATGAAGCTTGG - Intronic
1078407847 11:11086859-11086881 GACAAGGCCATCTTGGAGCTGGG + Intergenic
1078806461 11:14710498-14710520 GAAAAGACTCTGATGGACTTTGG - Intronic
1081274307 11:41128314-41128336 GAAAAGGAAATGATTGAGCTTGG + Intronic
1081582253 11:44360387-44360409 GAACAGGCCCTGATCATGCTGGG + Intergenic
1084461027 11:69296677-69296699 GAAAATGACCAGAAGGAGCTGGG - Exonic
1086839160 11:91664122-91664144 GAAATGACCCTCAGGGAGCTGGG + Intergenic
1089376371 11:117997952-117997974 GCAAAGGCCCTGAGGCAGCACGG + Intronic
1091166671 11:133482443-133482465 GAAAAGCCCCTGGAGGATCTGGG + Intronic
1091716940 12:2784270-2784292 GAAAAGGAGCTGATGGAGGATGG + Intergenic
1092534891 12:9378640-9378662 GAAAAGGAGCTGATGGAGAATGG - Intergenic
1092656494 12:10690195-10690217 GGCAAGACCCTGATGAAGCTGGG - Intergenic
1094211381 12:27896585-27896607 GAAGAGGCCTTGAAAGAGCTGGG + Intergenic
1094240146 12:28213037-28213059 GGAAAGACCCTGATGAAGCTGGG + Intronic
1095525333 12:43118268-43118290 GGAAAGACCCTGATGAATCTGGG - Intergenic
1096808966 12:54157697-54157719 GAAAAGGACTTACTGGAGCTGGG + Intergenic
1098974566 12:76889104-76889126 GAAAAGCCCCTGATGGAAGTTGG - Intergenic
1099995381 12:89772278-89772300 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1100330023 12:93573006-93573028 GCGAAGGCCCTGCGGGAGCTCGG + Exonic
1100614744 12:96222263-96222285 GAGAAGGCCCTATTTGAGCTGGG + Intronic
1101510121 12:105385376-105385398 GAAAGAGGCCTGAAGGAGCTTGG + Intronic
1103567936 12:121826487-121826509 GCAAAGGCCCTGAGGCAGCAGGG + Intronic
1104737986 12:131151644-131151666 TAAAAAGACCTGAGGGAGCTGGG + Intergenic
1104768789 12:131346950-131346972 GAAAAGGGCCTGGGGGAGATGGG + Intergenic
1105700310 13:22930659-22930681 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1106021506 13:25920160-25920182 GAAAAGGCCGAGAAGGAGTTGGG - Intronic
1107646241 13:42496895-42496917 GAAATGGCCCTCAAGGAGCTAGG - Intergenic
1112250287 13:97772888-97772910 GGAAGGACCCTGATGAAGCTGGG - Intergenic
1112507644 13:99984833-99984855 GAGAAGGACCTGAGGGGGCTGGG - Intronic
1113422115 13:110178960-110178982 GAATAGGCCCCCCTGGAGCTAGG - Exonic
1116243630 14:42379568-42379590 GAAAATGCCCTCATGGAGGCAGG + Intergenic
1117579405 14:57137082-57137104 GCAAAGGCCCAAATGGTGCTGGG - Intergenic
1119564003 14:75613304-75613326 TGAAAGGCAATGATGGAGCTAGG + Intronic
1120100633 14:80441245-80441267 GAAAAGCCCCAGATGTGGCTGGG + Intergenic
1121334909 14:93071309-93071331 CCAGAGGCCCTGATGGGGCTGGG - Intronic
1122308937 14:100782696-100782718 GAAATGGCCCAGTTGCAGCTGGG + Intergenic
1122841834 14:104468625-104468647 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1125490916 15:40147776-40147798 GAACAGGCCTGGCTGGAGCTTGG - Intergenic
1125552172 15:40553450-40553472 GAGAAGCCCCAGATGGGGCTTGG + Intronic
1125881876 15:43202322-43202344 GAACAGTCCCTGACGGGGCTGGG - Intronic
1128127440 15:65203536-65203558 TCAAAGACCCTGAGGGAGCTAGG - Intronic
1130251249 15:82301516-82301538 CTAATGGCCCTGTTGGAGCTGGG - Intergenic
1130707086 15:86243572-86243594 AGCAAGGGCCTGATGGAGCTAGG + Intronic
1132465882 16:77337-77359 GGACGGGCCCTGAGGGAGCTGGG - Intronic
1134018768 16:10907353-10907375 TCAGAGGCCCTGCTGGAGCTTGG + Exonic
1134207875 16:12252604-12252626 GAAAGGGCACTGATGGAACCGGG - Intronic
1135422203 16:22313110-22313132 GAAGAGGCCCTGCTAGAACTGGG - Intronic
1136278686 16:29194409-29194431 GAAAAGACCGCGATGGAGCCAGG - Intergenic
1136372900 16:29847341-29847363 GCAAGGTCCCTGATGGTGCTGGG - Exonic
1137831753 16:51550372-51550394 GAAACAGCCCTGATGGATATAGG + Intergenic
1138308109 16:55997134-55997156 GAAGAGGCCTGGTTGGAGCTCGG + Intergenic
1141031269 16:80591102-80591124 GTAACAGCCCTGGTGGAGCTGGG - Intergenic
1142083078 16:88160490-88160512 GAAAAGACCGCGATGGAGCCAGG - Intergenic
1142499994 17:326933-326955 GAGAAGGCCCTGGGGCAGCTTGG + Intronic
1143102922 17:4514047-4514069 GACATGGCCCTGTGGGAGCTGGG + Intronic
1143571102 17:7759172-7759194 GAGAATGGCCTGATGGAACTGGG - Intronic
1144874303 17:18389253-18389275 GAAAAGGTCCTGAGGCAGCAGGG - Exonic
1145157925 17:20555165-20555187 GAAAAGGTCCTGAGGCAGCAGGG + Intergenic
1146595706 17:34166613-34166635 GAATAGGCTGTGATGGAGCTGGG + Intronic
1147192466 17:38746120-38746142 GAAAAGGGCCTCCTGAAGCTGGG + Intronic
1147808702 17:43151047-43151069 GCAAAGGCCCTGAGGGCCCTAGG - Intergenic
1149236364 17:54594918-54594940 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1149380318 17:56087125-56087147 GAGATGGCACTGATGGAGCCAGG + Intergenic
1152710249 17:81867715-81867737 TAAATGCCCCTGAAGGAGCTGGG - Exonic
1153209215 18:2741333-2741355 GAAAAGGACATGCTGGAGTTGGG + Intronic
1154347655 18:13556715-13556737 GAAAAGGCCATGATGGGGAGTGG + Intronic
1155337345 18:24778063-24778085 GAGAAGACCCTGATGAAGGTGGG - Intergenic
1155822737 18:30398441-30398463 CGAATGACCCTGATGGAGCTGGG - Intergenic
1157424898 18:47576620-47576642 GAAAAGGCCCCCATGGAGTGAGG - Intergenic
1159287436 18:66372790-66372812 GAGGGGACCCTGATGGAGCTGGG + Intergenic
1159692590 18:71508227-71508249 GACAAGGCCATGTTGGATCTAGG - Intergenic
1160175734 18:76592561-76592583 GAAACGGCCCAGAGGGGGCTGGG - Intergenic
1161015158 19:1979684-1979706 GAAACTGCCCTGAGGGAGATGGG + Intronic
1161513489 19:4684154-4684176 TAAAAGGGCCTGATGGAGGGAGG + Intronic
1161737398 19:5999885-5999907 GCAAAGGCCCTGAGGCAGCGTGG + Intronic
1163587618 19:18172729-18172751 AAAAAGGCCCAGATGGAGGCTGG - Intronic
1164925809 19:32129155-32129177 GAAAAATCCCAGCTGGAGCTTGG + Intergenic
1164931140 19:32177260-32177282 GAAAAGGCAATGAGGGAGCTGGG + Intergenic
1167041640 19:47026333-47026355 GCAAAGGCCCTGAGGCAGGTGGG + Intronic
1167618092 19:50547221-50547243 GACAAGGCCCTGCGGGAGCGGGG + Intronic
926964463 2:18395043-18395065 TAAAAGGACCTGTTGGAGTTTGG - Intergenic
928986571 2:37188202-37188224 GGAAAGGCCATGATGGAGGATGG - Intronic
932086683 2:68768890-68768912 GACACAGCCCTGATGGATCTGGG - Intronic
933568972 2:83985761-83985783 GAAAAAGACATGATGGAGATAGG - Intergenic
934574189 2:95390154-95390176 GAACAGGCCCTGATGGTGATGGG + Intergenic
936505570 2:113102956-113102978 GACAAGGCACAGAAGGAGCTGGG + Intergenic
938828000 2:135025679-135025701 GAAAAGGCCATGTGGGGGCTGGG - Intronic
939126767 2:138186960-138186982 GAAAAGCCACTCATGGGGCTGGG - Intergenic
939868585 2:147502836-147502858 GAAAAGGCTTTGATGGGACTAGG - Intergenic
943384371 2:187183531-187183553 GAAAGGACCCTGATAAAGCTAGG - Intergenic
943395189 2:187324623-187324645 GAGAAGACCCTGATGAAGCTGGG - Intergenic
945168617 2:206972460-206972482 GAAAAAGCACTGATAGAGTTTGG - Intergenic
945308344 2:208281756-208281778 AAGAAGATCCTGATGGAGCTGGG - Intronic
945313401 2:208342621-208342643 GCAAAAGCAATGATGGAGCTGGG - Exonic
946202425 2:218078391-218078413 ACAAAGGCCCTGATGGAGGACGG + Intronic
947909008 2:233789637-233789659 GGGAAGGCACCGATGGAGCTTGG - Intronic
1169249286 20:4047818-4047840 GAGAAGGCAGTGAGGGAGCTGGG + Intergenic
1169276124 20:4234849-4234871 GCAAAGGCCCTGAGGCAGCAGGG + Intronic
1169783466 20:9333542-9333564 GAAAAGGTCCTGAACGATCTGGG - Intronic
1170180916 20:13529028-13529050 GAAAAGGCCCTCTTGAAGCAGGG - Intronic
1172276125 20:33680309-33680331 GAAAAGGTACCTATGGAGCTTGG - Exonic
1172479409 20:35262095-35262117 GAAAAGGCCCTGAGCTGGCTGGG - Intronic
1173834137 20:46114011-46114033 GAAAAGGACTTGGTGGAGGTGGG - Intergenic
1173992727 20:47315608-47315630 GAAAGGGTCCTTATGGAGCCTGG - Intronic
1174355584 20:49995736-49995758 GCAAAGGCCCTGAGGGGGCAGGG - Intergenic
1174697838 20:52578455-52578477 GCAAAGGCCCTGACTGAGGTTGG + Intergenic
1175893125 20:62324037-62324059 GACGAGGCCCTGATGGTGCCAGG - Intronic
1176227745 20:64011636-64011658 GAATGGGCCCTGAGGGACCTGGG + Intronic
1177630325 21:23718857-23718879 GAAAATGCCCTCCTGGATCTGGG - Intergenic
1178061099 21:28853825-28853847 GAGAGGACCCTGATGAAGCTGGG - Intergenic
1178483993 21:33005515-33005537 AAGAAGGGCCTGAGGGAGCTTGG + Intergenic
1181584323 22:23844843-23844865 GCAAAGGCCCTGAGGTAACTGGG + Intergenic
1182428307 22:30286320-30286342 GCAAAGAACGTGATGGAGCTGGG + Exonic
1183337147 22:37256357-37256379 GGAAAGTCCCTGATGGAGAGAGG - Intergenic
1183998522 22:41654719-41654741 GAGAAGGCCCCCATGGAGCTGGG + Intronic
1185097945 22:48821896-48821918 GCAGAGGCCCCGAGGGAGCTAGG - Intronic
949897946 3:8784098-8784120 CAAGAGACCCTGAAGGAGCTTGG - Intronic
950496810 3:13338787-13338809 GGAAAGGCCCTGGTGGTCCTTGG - Intronic
950676689 3:14558441-14558463 CCAAAGGCACTGATGGAGCTAGG - Intergenic
951978378 3:28539913-28539935 GAAAAGACCCTGATGAATCTGGG + Intergenic
952763398 3:36934978-36935000 GAAGAGGCCATGCTGGAGCTGGG - Intronic
953414190 3:42706042-42706064 GGAAACGCCATGATGGAGCTGGG - Intronic
953897750 3:46815177-46815199 GAGAGGACCCTGATGAAGCTGGG - Intergenic
954124954 3:48522678-48522700 GAAAAGCCCCTCATGCAGGTAGG + Intronic
954644860 3:52124964-52124986 AAAAAGGCCCTGATGGCGCTTGG - Intronic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
956933023 3:74067589-74067611 CAAAATGCCCTGATGAAGCCAGG - Intergenic
957128666 3:76196064-76196086 GAAAAGGCACTGATGTACCCAGG - Intronic
957131155 3:76223523-76223545 GGAAAGCTCCTGATGAAGCTGGG - Intronic
957448849 3:80349751-80349773 GAAATGACCCTGATGAAGATGGG + Intergenic
958696068 3:97528317-97528339 TAAAAGGGCCTGTTGGTGCTGGG + Intronic
959149121 3:102587451-102587473 GAAAGGGCTCTGATGGACATGGG + Intergenic
960495088 3:118363439-118363461 GGAAAGACCCTGATGAAGCTGGG - Intergenic
961403818 3:126665311-126665333 GGAAAGGCCCTGGTGGCCCTTGG + Intergenic
961969463 3:130945126-130945148 TGAGAGGCACTGATGGAGCTAGG + Intronic
962994737 3:140614615-140614637 GAAGAGGCTGTGATGGACCTTGG - Intergenic
963280853 3:143383718-143383740 GGAAGGGCTCTGGTGGAGCTTGG - Intronic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
965207548 3:165741792-165741814 GAAAACACCCTGATGAAGCTCGG + Intergenic
967216848 3:187218446-187218468 GACAAGTGTCTGATGGAGCTGGG + Intronic
967298230 3:187986505-187986527 GAAAAGGAGCTGATGTAGCCTGG - Intergenic
967505640 3:190249858-190249880 GGGAGGACCCTGATGGAGCTGGG - Intergenic
968745109 4:2355992-2356014 GAAACGGCCCCGACGGAGATGGG - Intronic
968945376 4:3660938-3660960 GAGAGGGCCCTGAGGCAGCTGGG + Intergenic
969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG + Intronic
970089551 4:12389031-12389053 GGGAGGGCCCTGATGAAGCTAGG - Intergenic
971979642 4:33735534-33735556 GGGAAGACCCTGATGAAGCTGGG - Intergenic
972171708 4:36353518-36353540 GACAACAACCTGATGGAGCTTGG + Intergenic
972235498 4:37129090-37129112 GAAAAGGCCTTAATGAAACTTGG + Intergenic
975024155 4:69528958-69528980 GAGAGGGTCCTGATGAAGCTGGG + Intergenic
976225693 4:82794397-82794419 GAAAAGGCCTTGATGTTTCTGGG + Intronic
977204286 4:94152612-94152634 GGAAGGACCCTGATGAAGCTGGG + Intergenic
977430406 4:96925558-96925580 GAGAGGACCCTGATGAAGCTGGG + Intergenic
977528563 4:98173472-98173494 GTAAAGGCTCTGCAGGAGCTTGG - Intergenic
977622426 4:99152795-99152817 GCAAGGGCCATGATGGATCTGGG + Intronic
977698055 4:99989328-99989350 GAAGATGCCCTTATGGAGTTGGG + Intergenic
978597663 4:110395769-110395791 TAAAAGGGCCTGATTCAGCTGGG + Intronic
978647882 4:110962241-110962263 GACAAGGAGCTGATGGAGCAGGG - Intergenic
982331346 4:154185080-154185102 CAAAAGGCCCTGATATGGCTTGG - Intergenic
990483529 5:56235307-56235329 GAGAAGACCCTGATGAAGCTGGG + Intergenic
991669397 5:69032767-69032789 GAAATGGCTCTGTTGGAGATGGG - Intergenic
992332746 5:75733916-75733938 CAAAAAGACCTGAGGGAGCTTGG - Intergenic
993412930 5:87594494-87594516 GGGAAGACCCTGATGAAGCTGGG - Intergenic
995075641 5:107980247-107980269 TAAAAGGACTTGATGAAGCTTGG + Intronic
996266218 5:121543924-121543946 GGAAAGAACCTGATGAAGCTCGG + Intergenic
998290696 5:140911271-140911293 AAAAGGACCCTGATGAAGCTGGG - Intronic
998416720 5:141951549-141951571 GAATTGGCCCTGATGCAGCAAGG + Exonic
1000076429 5:157791924-157791946 CAACAGGGCCTGATGGGGCTTGG + Exonic
1001072799 5:168601358-168601380 GCAAAGGCCCTGAAGGAGCTTGG - Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1002691748 5:181054725-181054747 GAAAAGGCCATCATGGTGTTGGG + Intronic
1004025610 6:11815341-11815363 GAAAATGCCAAGCTGGAGCTGGG + Intergenic
1005622830 6:27635703-27635725 AAGAAGACCCTGATGAAGCTGGG - Intergenic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1007688679 6:43683361-43683383 GAGAAGGCCCTGTTGGAACCTGG + Intronic
1012820457 6:104080271-104080293 GGAAGGACCCTGATGAAGCTGGG + Intergenic
1014136767 6:117898405-117898427 GAAAAGACTCTGAAGCAGCTTGG + Intergenic
1016420338 6:143875959-143875981 GGGAAGACCCTGATGAAGCTGGG - Intronic
1017044503 6:150334497-150334519 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1018217998 6:161549671-161549693 GAAAATGGTCTGATGGAGTTTGG - Intronic
1018852970 6:167654469-167654491 GCCAAGGCCCTGATGGATCTGGG + Intergenic
1019756483 7:2774467-2774489 ACAAGGGCCCTGATGGCGCTGGG + Intronic
1022861776 7:34375112-34375134 CAAAGTGCCCTGATGGAGATTGG - Intergenic
1022903508 7:34833772-34833794 GCTAAGGACCTGAGGGAGCTTGG - Intronic
1024159465 7:46659382-46659404 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1024995684 7:55271675-55271697 GCAAAGGCAGTGATGGCGCTGGG + Intergenic
1026171845 7:67960847-67960869 GAAAACGTCCAGAAGGAGCTTGG + Intergenic
1026390492 7:69896805-69896827 GCAAAGGCCTTGAGGCAGCTGGG - Intronic
1028340797 7:89717680-89717702 GAAAAGGGGCTGATGCAGGTAGG - Intergenic
1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG + Intronic
1031418544 7:121521807-121521829 GAGAATACCCTCATGGAGCTGGG + Intergenic
1031474791 7:122208020-122208042 GGAAGGACCCTGATGAAGCTGGG - Intergenic
1033814137 7:145051757-145051779 GAAAAGGCACTGAAGGGGCTAGG - Intergenic
1034404987 7:150897125-150897147 GAAATGGCATTGATGGTGCTTGG + Intergenic
1035657635 8:1322773-1322795 GAGAAGGCCCTGATGCAGGGGGG - Intergenic
1036142029 8:6217535-6217557 GAGAAGCCCCTGATGAGGCTGGG + Intergenic
1037762123 8:21748480-21748502 GAAGTGGCCTTGATGGGGCTAGG - Intronic
1039311565 8:36322363-36322385 GGAGAGGCCCTGAGGGAGCCTGG - Intergenic
1040486489 8:47877471-47877493 TAAAAGGCCAAGATGAAGCTTGG + Intronic
1042137332 8:65644878-65644900 GAACAGGAGCTGAAGGAGCTCGG + Intronic
1042600498 8:70494714-70494736 GAAAAATCACTGATGGAGCATGG - Intergenic
1043100536 8:76039753-76039775 GGGAAGACCCTGATGAAGCTGGG - Intergenic
1043232781 8:77823546-77823568 CAAAAGACCCTAATGAAGCTGGG - Intergenic
1044194469 8:89357894-89357916 GAAAAGCTCCTGATTGATCTGGG + Intergenic
1044516234 8:93142022-93142044 GAACAGACCCTGCTGGACCTGGG + Intronic
1044519264 8:93178801-93178823 GAAAAGGCCCTGCTTGAAATAGG + Intergenic
1047968742 8:130066884-130066906 GAAGAGGCCCTGTTGGGTCTGGG + Intronic
1048322651 8:133412398-133412420 GAAAGGGCATGGATGGAGCTGGG - Intergenic
1048326599 8:133443845-133443867 AATGAGGCCCTGATGGAGCAAGG - Intergenic
1048929617 8:139302346-139302368 CAAAACGTCCTGAGGGAGCTAGG + Intergenic
1049637958 8:143699373-143699395 AAAAAGGCCCTGAGGTGGCTGGG - Intronic
1052576975 9:30303340-30303362 GAGAAGACCCTGATAAAGCTGGG + Intergenic
1052718434 9:32146438-32146460 GGGAAGACCCTGATGAAGCTGGG + Intergenic
1052858195 9:33420196-33420218 GCAAAGGCCCCGAGGGAGCCTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057809944 9:98250140-98250162 GAGAAGGCAATGCTGGAGCTTGG + Intronic
1059428538 9:114236328-114236350 CAGACTGCCCTGATGGAGCTCGG + Intronic
1059649810 9:116305513-116305535 CAAAAGGCCCTGTAGGAGCATGG + Intronic
1061890515 9:133616834-133616856 TCCATGGCCCTGATGGAGCTGGG + Intergenic
1062101590 9:134731365-134731387 GCACAGGGCCTGATGGATCTGGG + Intronic
1062243868 9:135553347-135553369 GAAAAGACGCAGAGGGAGCTGGG - Intergenic
1062422240 9:136488363-136488385 AAAAGGGCCCGGGTGGAGCTGGG + Intergenic
1062481504 9:136754626-136754648 GAGAAGGCGCTCAGGGAGCTGGG - Intronic
1189372194 X:40437685-40437707 GGAAAGGCCCTGATGAAGCTGGG + Intergenic
1189665945 X:43354905-43354927 GAGAAGACCCTGATAAAGCTGGG - Intergenic
1190106305 X:47563265-47563287 GACAAGGCCCTGAAGGTGCGGGG + Exonic
1190411627 X:50141871-50141893 AAACAAGCCCTGATGGAGATGGG + Intergenic
1190527255 X:51340729-51340751 GAAAATGTCTTGATAGAGCTAGG + Intergenic
1192673592 X:73171065-73171087 GAAAGGACCCTGATGAAGCTAGG - Intergenic
1193832592 X:86307434-86307456 GAGAAGACCCTGATGAAGCTGGG + Intronic
1193879163 X:86900424-86900446 GAGAGGACCCTGATGAAGCTGGG - Intergenic
1193904249 X:87223871-87223893 GGAAAGACCTTGATGAAGCTGGG + Intergenic
1194106663 X:89778203-89778225 GAAAAGACCCTGATAAAGCTGGG + Intergenic
1196118323 X:112021103-112021125 GGAAAGGTCCTGTGGGAGCTGGG + Intronic
1199627435 X:149753275-149753297 GGAAGGACCCTGATGAAGCTGGG - Intergenic
1200250970 X:154553555-154553577 GGAGAGGCCCTGCTGGAGCATGG + Intronic
1200458627 Y:3426067-3426089 GAAAAGACCCTGATAAAGCTGGG + Intergenic
1202100103 Y:21298751-21298773 GGAAGGACCCTGATGAAGCTGGG + Intergenic