ID: 1064424340

View in Genome Browser
Species Human (GRCh38)
Location 10:15216913-15216935
Sequence ACATTTAAACTGATTCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 453}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064424340 Original CRISPR ACATTTAAACTGATTCATTT GGG (reversed) Intronic
900746741 1:4365907-4365929 ACATTTCAACATATGCATTTGGG - Intergenic
902065759 1:13685009-13685031 ACATTTAAATTGACAAATTTAGG + Intergenic
902345015 1:15810042-15810064 AGATTTAAACTAAGTCATTAAGG - Intergenic
903101259 1:21031910-21031932 AGATGTAAATTGATTTATTTGGG - Intronic
905158046 1:36004187-36004209 AAATTAAAACTGCTTAATTTTGG + Intronic
905518069 1:38576873-38576895 ACATTTGAAATGATTTAATTTGG - Intergenic
905721082 1:40202732-40202754 ACAATTAAAATCATACATTTTGG - Intronic
905850358 1:41269567-41269589 ACATTTAAACTTATTTGTCTAGG + Intergenic
905999368 1:42410796-42410818 ACATATAAACTCATTCAGTGAGG - Intronic
907078995 1:51604253-51604275 ACATTTAAAAAAATTCATTAGGG + Intronic
907589171 1:55649591-55649613 GCATTTAAGGTTATTCATTTAGG - Intergenic
908350012 1:63277364-63277386 AGGTTTTAACTGATTCATGTAGG + Intergenic
908826539 1:68138071-68138093 TCTTTTAATCTGAATCATTTCGG + Intronic
909779397 1:79523621-79523643 ACATTTACATTGTTTTATTTTGG - Intergenic
910836138 1:91513461-91513483 AGATTTGTACTGAATCATTTTGG + Intronic
911329388 1:96509819-96509841 GGATTTAAACTGAATCCTTTGGG + Intergenic
911902886 1:103526980-103527002 ACATTTAAACTGATCAAAATTGG - Intronic
912303554 1:108541582-108541604 GTATATAAACTGATTTATTTTGG - Intergenic
912986826 1:114441978-114442000 AAATTTGAATTAATTCATTTGGG - Intronic
912992453 1:114502194-114502216 ACATTTATAGTTCTTCATTTTGG - Intronic
913140316 1:115934879-115934901 ACTTTGAAACTGAATCAATTGGG + Intergenic
913507235 1:119528119-119528141 GGATTTAAACTGGTTCCTTTAGG - Intergenic
916833840 1:168521183-168521205 ATATTCAGACTGATTCCTTTTGG + Intergenic
916958366 1:169864052-169864074 ACATTTATCATGAATCATTTAGG - Intronic
917084943 1:171295970-171295992 AGTCTAAAACTGATTCATTTGGG + Intergenic
917284094 1:173406761-173406783 ACATTTGGACCGATTCATTCAGG - Intergenic
917473958 1:175352317-175352339 ACATTGAAACCCATGCATTTTGG + Intronic
918283347 1:183027024-183027046 TCATTTTAACTGATACTTTTTGG + Intronic
918692530 1:187499601-187499623 ATAATTAAACTCATTCAGTTAGG - Intergenic
918801134 1:188973382-188973404 ACATTTAATTTGATCCATATTGG + Intergenic
918850399 1:189680565-189680587 ATATTTAAAGTTATACATTTGGG - Intergenic
919016192 1:192039836-192039858 GCATTCAAAATTATTCATTTAGG - Intergenic
919544114 1:198891989-198892011 ATATTTAAAATGATTAAATTTGG + Intergenic
920606255 1:207390147-207390169 AAATTTAAAATGTTTTATTTGGG - Intergenic
922302781 1:224317430-224317452 ACATTTCAACTGATTCTTGAGGG + Intronic
924033438 1:239910629-239910651 AAATGTTAACTGTTTCATTTGGG + Exonic
1064348291 10:14553066-14553088 ACATTTAAACAGTTTTATTTGGG + Intronic
1064424340 10:15216913-15216935 ACATTTAAACTGATTCATTTGGG - Intronic
1065434895 10:25695729-25695751 ACATTTAATCTGATTACATTGGG - Intergenic
1065440766 10:25751357-25751379 ACAGTGAATCAGATTCATTTTGG - Intergenic
1065661942 10:28013340-28013362 ACATTTTGTATGATTCATTTTGG - Intergenic
1065847455 10:29757818-29757840 ACATTTAAATAGATTCTTTTGGG - Intergenic
1066087481 10:31985165-31985187 AAATTGAAAATAATTCATTTTGG + Intergenic
1066125817 10:32341811-32341833 AATTTCAAACTGAGTCATTTTGG - Intronic
1066543817 10:36477593-36477615 ACATTTAACCTGAATCACATGGG + Intergenic
1067226559 10:44380209-44380231 ACATTTGATTTTATTCATTTGGG - Intronic
1068070499 10:52188569-52188591 ACATTTATATTCATTCATTATGG - Intronic
1068409208 10:56633255-56633277 ACATTCTAACAGATTCAATTTGG - Intergenic
1068520936 10:58077119-58077141 TCTTGTAAAATGATTCATTTAGG + Intergenic
1068768145 10:60788162-60788184 ACAATTAAACTGGCTGATTTTGG + Exonic
1068792621 10:61043867-61043889 ACACTAAAAATGATTCTTTTGGG + Intergenic
1068987744 10:63122814-63122836 ATATTTTAACTGATTAAGTTAGG + Intergenic
1069292573 10:66799549-66799571 ATATTTAAACTGAAGCATTGTGG + Intronic
1069731217 10:70615732-70615754 ACATGTCAACGTATTCATTTTGG + Intergenic
1069922180 10:71822466-71822488 CCATTTAAAATGATGCATTAAGG + Intronic
1071594813 10:86912756-86912778 AAGTTTAAACTGATTGATTGAGG + Intronic
1072008435 10:91281364-91281386 AAATTTAAACTGATTATTTAAGG + Exonic
1072183431 10:93010731-93010753 ACTTTTAAACTGAGTCTTTAGGG + Intronic
1074550381 10:114437091-114437113 ACATTTATACTGATTTATACTGG - Intronic
1074577882 10:114687787-114687809 ACATGAAAAATGATTCCTTTGGG + Intergenic
1076129548 10:128003689-128003711 ACATTTATACTAATTAAGTTGGG - Intronic
1078259730 11:9694259-9694281 TTATTTAAACAGGTTCATTTTGG + Exonic
1079745847 11:24128976-24128998 ACATTTCAACACATTCACTTTGG - Intergenic
1080114031 11:28601728-28601750 AGATTTCAACATATTCATTTTGG + Intergenic
1080940895 11:36916681-36916703 AATATTAGACTGATTCATTTTGG + Intergenic
1081410339 11:42750206-42750228 TCATTTGAACAGATTCATTATGG - Intergenic
1082223995 11:49679042-49679064 AGACTGAATCTGATTCATTTGGG + Intergenic
1084206703 11:67598722-67598744 ATAGTTAAATTCATTCATTTAGG - Intergenic
1084578518 11:70006968-70006990 ACATTTAAAATGATTAAAATGGG - Intergenic
1085596680 11:77817802-77817824 AGATTTGAACTGAGTCTTTTTGG - Intronic
1085739412 11:79066039-79066061 ACATTTAAACCAATTCATGCCGG + Intronic
1085984658 11:81770822-81770844 AAATTTAAAATGTTTTATTTGGG - Intergenic
1086625044 11:88940127-88940149 AGACTGAATCTGATTCATTTGGG - Intronic
1087050025 11:93877385-93877407 GCTTTTAAACTGCTTCCTTTTGG - Intergenic
1087183912 11:95165835-95165857 ACACATAAACTGATCCATTTAGG + Exonic
1087531831 11:99392559-99392581 ATATCTAAAGTAATTCATTTAGG - Intronic
1087535359 11:99437525-99437547 ATATTAAAAGTGATTAATTTGGG + Intronic
1087862212 11:103173340-103173362 ACATTTCTAATGATTGATTTTGG + Intronic
1087960852 11:104347361-104347383 AGATTTCAACTTATGCATTTAGG - Intergenic
1088808916 11:113376544-113376566 ACATTTTAACTGATACCTTAAGG - Intronic
1088862004 11:113809225-113809247 ACATTTGATCTGATTCAGTTGGG + Exonic
1090704324 11:129322783-129322805 AGAATTAAACTTATTCATTTAGG + Intergenic
1090793497 11:130113284-130113306 AAATTTAAACTCTATCATTTGGG - Intronic
1092520512 12:9267702-9267724 GCATTTCAACTGATTTATATAGG - Intergenic
1092800574 12:12161781-12161803 ACATTTAAAAAGCTTTATTTTGG - Intronic
1093379687 12:18477584-18477606 CCATTTAATCCCATTCATTTTGG - Intronic
1095243845 12:39894623-39894645 AAAATTAAACTGATCTATTTGGG + Intronic
1097493160 12:60295881-60295903 ACAGTAAAACTGATTCATTCTGG + Intergenic
1099640052 12:85275004-85275026 ACATTTAAATTGGATCCTTTAGG + Intergenic
1100161831 12:91869693-91869715 ACATTTACATTGTTTTATTTTGG + Intergenic
1101179868 12:102204245-102204267 TCATTGAAACTGCTTCATTAAGG - Intergenic
1101271886 12:103156144-103156166 ACATTCAAACTGATTCAAAGAGG - Exonic
1101641635 12:106589399-106589421 ACATAAAAATTGAGTCATTTTGG + Intronic
1101717959 12:107327465-107327487 ACTTTCAAACTGGTTAATTTAGG + Intronic
1102327297 12:111998024-111998046 AAATTTAAAATGTTTTATTTGGG + Intronic
1106356166 13:28985748-28985770 ACATTTAAATTGAAGGATTTTGG + Intronic
1106630355 13:31465718-31465740 ACAGTTAAACTGATTTCATTTGG - Intergenic
1106745948 13:32707197-32707219 ACATGTAATCTGATTATTTTGGG + Intronic
1106941329 13:34782983-34783005 ACATTTAAAATCTGTCATTTAGG - Intergenic
1107214831 13:37904157-37904179 ACATTTAAACTAATCCAGGTAGG - Intergenic
1107423219 13:40268966-40268988 ACATGTAAACTCCTTCACTTTGG - Intergenic
1107679532 13:42834025-42834047 TCATATAAAATGCTTCATTTGGG - Intergenic
1107812725 13:44215731-44215753 ACATTTAAACTGAATAAGTCAGG + Intergenic
1107916938 13:45161893-45161915 ACTTTTAAACTATTTCTTTTAGG + Intronic
1108954820 13:56139913-56139935 ACATTTATTCTGAGTCATTCTGG + Intergenic
1109312245 13:60709732-60709754 ACATTTAAAGTGAATAATTGAGG + Intergenic
1109502934 13:63261229-63261251 ACATTTCAACAGTTTCATTTTGG - Intergenic
1109720716 13:66272781-66272803 AAAATTGAACTTATTCATTTAGG + Intergenic
1109772588 13:66996723-66996745 ACATTTAGACACATTCATTCAGG - Intronic
1110164429 13:72421931-72421953 TCATATATACTGATTCATCTTGG - Intergenic
1110285035 13:73740054-73740076 ACATTGAAACTGTCTCATTTAGG + Intronic
1110416229 13:75256093-75256115 CCAGTTAATCTGATTTATTTGGG - Intergenic
1110664821 13:78104605-78104627 ACATTTTTATTGATTTATTTTGG - Intergenic
1110681165 13:78313532-78313554 ACATTTACATTGATTTAATTAGG + Intergenic
1111345846 13:86953239-86953261 AAATTTAAAATGTTTTATTTTGG + Intergenic
1111462446 13:88563416-88563438 ACAGTTAAAATGATTGATTTTGG + Intergenic
1111488162 13:88931870-88931892 ACATTTTAATTGATTTTTTTTGG + Intergenic
1111544398 13:89711831-89711853 ACATTTAAATTAATACTTTTTGG + Intergenic
1112160750 13:96865394-96865416 ACATTTGAACTCAGTCATTCTGG + Intergenic
1112772406 13:102805300-102805322 AAGTCTAAACTGATTCCTTTAGG - Exonic
1112833227 13:103479080-103479102 ACATTTAATCATATTCTTTTTGG + Intergenic
1113124791 13:106965270-106965292 AAGGTTAAACTGATTCAGTTTGG + Intergenic
1114877028 14:26732751-26732773 AAATATAAACTGTTTTATTTAGG - Intergenic
1115110609 14:29816953-29816975 GTATTTAAAATGAATCATTTTGG - Intronic
1115114587 14:29864689-29864711 ATCTTCAAAATGATTCATTTTGG - Intronic
1115917119 14:38328059-38328081 ACATTTCAACTTATGAATTTTGG + Intergenic
1116346070 14:43796060-43796082 ATATTTACACTTAATCATTTTGG - Intergenic
1117034203 14:51710286-51710308 CCATTAAATCTGCTTCATTTAGG + Intronic
1117544385 14:56780304-56780326 ATATTTCAACTGATTCAAATGGG - Intergenic
1117979222 14:61325489-61325511 ACAGTTAAACTCTTACATTTAGG - Intronic
1119549842 14:75500657-75500679 ACAGATAAACTGATTCAATCTGG - Intergenic
1119754186 14:77102769-77102791 GCATTCAAACTAATTCATGTCGG - Intronic
1119956937 14:78808819-78808841 TCCTTTAAAATGATTCACTTTGG + Intronic
1120370242 14:83624898-83624920 ACAGGTAAACTGTTTCATTTTGG + Intergenic
1120464594 14:84840321-84840343 TTATTTGAACTGATTCATCTTGG - Intergenic
1123413486 15:20078638-20078660 ACTTTCAAACTCATTCATTGAGG - Intergenic
1123522828 15:21085750-21085772 ACTTTCAAACTCATTCATTGAGG - Intergenic
1123958844 15:25372307-25372329 AAAATCAAACTGGTTCATTTTGG + Intronic
1124657219 15:31518092-31518114 TCATCCAAACTGGTTCATTTGGG - Intronic
1125125385 15:36214159-36214181 ACATTGAAACTTTTTCATCTTGG - Intergenic
1125213735 15:37245146-37245168 ACATATAATTTGGTTCATTTTGG + Intergenic
1125867270 15:43064088-43064110 AGATTCAATCTGATTCATCTTGG + Intronic
1126267401 15:46770495-46770517 ACATATTAACTGCTTCATCTGGG + Intergenic
1127137548 15:55940404-55940426 AAATTTTAACTGATTTATTGGGG - Intronic
1127642376 15:60928138-60928160 ACATTTAAAGGGATTTATTCAGG - Intronic
1127665311 15:61140403-61140425 GCATTTAAACTGAGTCTTTAAGG - Intronic
1129438393 15:75560448-75560470 ACAATTAAACAGTTTTATTTGGG - Intronic
1129486750 15:75881089-75881111 ACATTTTTACTAATTCATATGGG + Intronic
1130170992 15:81513597-81513619 GCACTTAATCTGATTCTTTTAGG - Intergenic
1130202072 15:81841381-81841403 ACCTTAAAAGTGATTCTTTTCGG + Intergenic
1130420530 15:83742512-83742534 AAATTTAAACCTAGTCATTTGGG + Intronic
1131963849 15:97816931-97816953 ACATTTAAAATAATGCATTTTGG + Intergenic
1132271313 15:100528485-100528507 GAGTTTAAACTGATTCATTGAGG - Intronic
1133676885 16:8081746-8081768 ACACATAAACTGCCTCATTTAGG - Intergenic
1134144951 16:11753402-11753424 AGATTTGAACTCATTCATTGTGG + Intronic
1134432168 16:14220294-14220316 ACAGTTACACTTATCCATTTGGG + Intronic
1137883776 16:52080044-52080066 ACATTTAAAATGTTTCTTATAGG + Intergenic
1138002792 16:53299365-53299387 CCTTTTAATCTGATTAATTTGGG - Intronic
1139019861 16:62734702-62734724 ACATTAAAATTGATTTATGTAGG - Intergenic
1140865101 16:79053308-79053330 ACATTAAAACGGCTTCATTCGGG - Intronic
1141893886 16:86946327-86946349 ATTTTTGAAATGATTCATTTGGG + Intergenic
1145744536 17:27305531-27305553 ACATATAAACTCTTTCATTAGGG - Intronic
1146401910 17:32506265-32506287 ACAATAAAAATGACTCATTTGGG + Intronic
1149084680 17:52701074-52701096 ATATTTAAATTGAATCATCTAGG + Intergenic
1153137496 18:1933357-1933379 ACATTTACTCTGAATCATATAGG + Intergenic
1153235884 18:2987005-2987027 ACATTTAAACAGAAACAATTAGG - Intronic
1153554127 18:6293098-6293120 ATATTTAAAATGTTTTATTTGGG - Intronic
1153571880 18:6481860-6481882 AGAATTAAACTGATTCGTTATGG - Intergenic
1153880232 18:9416063-9416085 CCATTTAACCTGATTTTTTTAGG - Intergenic
1155679457 18:28472124-28472146 ACAATTAAACTTTTTCAATTAGG - Intergenic
1155792687 18:29994649-29994671 AGATTTAAACTGATTGGATTTGG + Intergenic
1155821161 18:30379161-30379183 AGATTTTTACTGATTCTTTTTGG - Intergenic
1155936685 18:31761972-31761994 ACATTTATACTGATTGATTTTGG + Intergenic
1156336301 18:36175522-36175544 ACATTTAAACTGACAGATGTAGG + Intronic
1156738655 18:40296711-40296733 ACATATAAACTCATGCAATTGGG - Intergenic
1157803475 18:50639989-50640011 ATATTTAAACTGATTCCATTAGG - Intronic
1158567096 18:58563462-58563484 ACTTTGAGACTGACTCATTTAGG + Intronic
1158794745 18:60831024-60831046 ACTTTTAGACTGCTCCATTTTGG + Intergenic
1159977495 18:74732073-74732095 ACATTTTAAGTGTTTCACTTGGG + Intronic
1160470926 18:79132777-79132799 ACATTTGGACTGTGTCATTTTGG + Intronic
1160611246 18:80087607-80087629 ATATATATAATGATTCATTTGGG - Intronic
1165168499 19:33873472-33873494 ACATTTAAGCTGATGGATTCAGG - Intergenic
1165285228 19:34836343-34836365 AAATATAAACTGTTTTATTTGGG - Intergenic
924965832 2:75653-75675 ACATTTAAACATTTTCCTTTTGG + Intergenic
925424584 2:3738148-3738170 ACATTTGAACTGATGAAATTTGG + Intronic
925883592 2:8373696-8373718 ATATTTTAACTGTTTCATCTCGG - Intergenic
926531007 2:14045012-14045034 AGTATTATACTGATTCATTTAGG + Intergenic
926576842 2:14592056-14592078 AGATTTCAACAGATTAATTTGGG - Intergenic
927077317 2:19591879-19591901 ATAATTAAACTAATTCATTAAGG + Intergenic
927113526 2:19880933-19880955 ACATGGAAACTGAAGCATTTTGG - Intergenic
927346439 2:22048824-22048846 ACATTTAAAATGATTACTATTGG + Intergenic
927626410 2:24724746-24724768 ACTTTTAAATTAATTAATTTTGG + Intronic
928045048 2:27922837-27922859 AAATTAAAAGTGATTCAATTTGG + Intronic
928060556 2:28108627-28108649 ACATTTATAGTTTTTCATTTAGG + Intronic
929930512 2:46252069-46252091 AGTCTTAATCTGATTCATTTAGG + Intergenic
930313880 2:49773382-49773404 GGATTTAGACTGATTCATCTTGG + Intergenic
931583765 2:63805464-63805486 AAATTGAAACTGACTCAGTTTGG + Intronic
932790853 2:74653619-74653641 ACATTTGAACTGATTCTTCTAGG - Intergenic
932984677 2:76710828-76710850 ACATTTGAACTTTTTCACTTTGG + Intergenic
934998161 2:98985657-98985679 ACATTTAGGTTGATTCCTTTAGG + Intergenic
935070987 2:99693270-99693292 ACATTTAAAATTACCCATTTTGG - Intronic
935242707 2:101192302-101192324 ACATGTAAGTTGATTCATTTGGG - Intronic
936552323 2:113456342-113456364 ACATTCAAAATGAATAATTTGGG - Intronic
936832509 2:116665252-116665274 ACAGTTACAGTGTTTCATTTGGG - Intergenic
938648097 2:133351939-133351961 ACATTTTAACAGCATCATTTTGG - Intronic
939424303 2:142015056-142015078 ACATTTAAATTGTTTCCTTATGG + Intronic
939591390 2:144067705-144067727 ACATTTAAAATGATTCAAACAGG + Intronic
940323149 2:152398507-152398529 ACATTCAAACTGATGATTTTTGG + Intronic
941711345 2:168717256-168717278 TCATTTCAACTAATCCATTTAGG - Intronic
943209194 2:184940742-184940764 CCATTTAAAGTGACTCAATTGGG - Intergenic
943461896 2:188179528-188179550 ACATTTAAAATGAATCATGCAGG - Intergenic
943916869 2:193645824-193645846 ACATTTAATATGCTTCAGTTAGG + Intergenic
943967893 2:194361725-194361747 TCATTTAAACTTATTTATTTTGG + Intergenic
943968923 2:194377975-194377997 ACTTGTAAACTCAATCATTTTGG + Intergenic
944321334 2:198347025-198347047 AAATTTTAAGTTATTCATTTGGG + Intronic
945223975 2:207513244-207513266 ACATTGAAAATGATTAATATTGG - Intergenic
945587241 2:211681264-211681286 ACATTTAGACTGTTCCATTTTGG + Intronic
945633515 2:212316550-212316572 ACCTTTACACTGGATCATTTGGG - Intronic
945892030 2:215439862-215439884 ACATTTCAAATGTTACATTTAGG + Intergenic
946681751 2:222224293-222224315 ACATTTAAATTCCTTCCTTTGGG - Intronic
946992894 2:225355483-225355505 ACTGTTAAACTGATTAACTTTGG + Intergenic
947556150 2:231095078-231095100 ACAATTGAACTGAATAATTTGGG + Intronic
1170102864 20:12721401-12721423 ACATTTCAAATGTTTCAGTTGGG - Intergenic
1170273707 20:14557952-14557974 ACATTTAAGTTGTTCCATTTTGG - Intronic
1170915759 20:20623727-20623749 ACAATTAAACTTATCCATTTAGG + Intronic
1171540581 20:25950216-25950238 AAAGTCAAATTGATTCATTTAGG - Intergenic
1171800495 20:29610116-29610138 AAAGTCAAATTGATTCATTTGGG + Intergenic
1171843609 20:30246591-30246613 AAAGTCAAATTGATTCATTTGGG - Intergenic
1174421966 20:50405173-50405195 ACATTTGAACTGCTTCAAATGGG - Intergenic
1176206688 20:63892558-63892580 AGATTTACACTAATTTATTTTGG + Intergenic
1176839978 21:13832059-13832081 ACATTTCAAGTAAGTCATTTTGG - Intergenic
1176986153 21:15439259-15439281 ACATTTAAACTCCTACATTAGGG - Intergenic
1177186044 21:17798084-17798106 AGATTTAAACTGGTTAATTCTGG - Intronic
1177380138 21:20329618-20329640 ACATAAAAACTGAGTCAATTTGG - Intergenic
1177564855 21:22807157-22807179 AGATTAGAACTGACTCATTTTGG + Intergenic
1177649311 21:23940066-23940088 AGACTTAAACTGATGCATATAGG + Intergenic
1177687741 21:24461733-24461755 ACATTTTAGCTTATTCCTTTTGG + Intergenic
1178027441 21:28484232-28484254 ACATTTAGACAGATTTTTTTGGG - Intergenic
1179280876 21:39933260-39933282 ACAATTATACTAATTTATTTAGG - Intergenic
1182265879 22:29114895-29114917 ACATTTTATCTTAATCATTTTGG - Intronic
1182824686 22:33254563-33254585 GAATTTAAACTGAGTCATTCTGG - Intronic
1183972867 22:41491400-41491422 AACTCTAAACTGATTTATTTAGG - Intronic
1184933220 22:47697422-47697444 ATATTTAAAGAGATTTATTTTGG + Intergenic
949188359 3:1220479-1220501 AAATATAAACTAATTTATTTGGG + Intronic
949486554 3:4545184-4545206 ACAGATCAACTGATTCATTTTGG - Intronic
949633914 3:5961138-5961160 TTCTTTAAACTGACTCATTTTGG + Intergenic
949636111 3:5982863-5982885 ACAGCTACACTGATTTATTTTGG - Intergenic
950716614 3:14852176-14852198 ACATTTGAATTGTTTCTTTTTGG - Intronic
951265153 3:20556473-20556495 AAATTTAAATTGAATCATGTGGG + Intergenic
951763645 3:26172481-26172503 AAATTCACACTGATGCATTTAGG - Intergenic
951846395 3:27089234-27089256 CAACCTAAACTGATTCATTTAGG + Intergenic
952111989 3:30134683-30134705 ACAAATAAACTCATTCTTTTTGG + Intergenic
952298075 3:32078962-32078984 AGATTTAATCTGGTCCATTTGGG + Intergenic
953873660 3:46649847-46649869 ACATTTAAAGTGATTATTTATGG - Intergenic
955552016 3:60095273-60095295 ACATTCCACCTGTTTCATTTGGG - Intronic
956330270 3:68099312-68099334 ACTTTTAAACGGGGTCATTTTGG - Intronic
957127539 3:76181047-76181069 ACATTTAAACTGAGCCCTTAAGG - Intronic
957384176 3:79473566-79473588 GTATTAAAAATGATTCATTTTGG - Intronic
957416532 3:79913181-79913203 ACATTTAGACTGACTCTTGTAGG + Intergenic
957541600 3:81577199-81577221 ACCTTTAATCTGATTCCTTTGGG - Intronic
957858314 3:85908294-85908316 GCATTTAAACTTACTTATTTTGG + Intronic
958069346 3:88589546-88589568 ACATAAAAACTGAATAATTTGGG - Intergenic
958167416 3:89894768-89894790 ACATTTAAAATGATTAACCTTGG - Intergenic
959814096 3:110654989-110655011 ACTTTTAAAGTGATTTAATTGGG + Intergenic
959850923 3:111085747-111085769 ACATTAAAACTGATAAATTATGG - Intronic
959951216 3:112183016-112183038 ACATTTAGATTGCTTCATTTGGG + Intronic
960493769 3:118350892-118350914 ACATCTAAACTGAGCCATCTAGG + Intergenic
960615189 3:119590008-119590030 ACATTTCAAATGATGCTTTTTGG + Intergenic
960816244 3:121676058-121676080 ACAGTTTAACTAATTCATTTGGG + Intronic
961800296 3:129442847-129442869 ACATTTAAATTTATACTTTTAGG + Intronic
962060769 3:131924772-131924794 ACGTTTACACTGATTAGTTTAGG - Intronic
962638984 3:137363381-137363403 ACATTTCAACTCATTCTATTAGG + Intergenic
962733694 3:138305270-138305292 ACTTTTAAGTTGACTCATTTGGG + Intronic
962918685 3:139932433-139932455 ACATTTGATTTGATTCATTTGGG - Intergenic
963390049 3:144649852-144649874 ACATTTAAATTGATATATTAAGG - Intergenic
964112554 3:153102893-153102915 AAATTTAAACTGCTTCCTCTTGG + Intergenic
964677032 3:159295062-159295084 ACCTTTATATTGAATCATTTAGG - Intronic
964925638 3:161953561-161953583 ACAGTTAAACTGTGTCCTTTAGG + Intergenic
965236288 3:166128040-166128062 AAGTTTAAATTGGTTCATTTGGG + Intergenic
965792057 3:172400407-172400429 ACATTCAAACACATTCAATTAGG - Exonic
965811675 3:172597507-172597529 ACATTTAAGCTGGTACATTTTGG + Intergenic
966220967 3:177550711-177550733 ACATTTAATCTGAATCACATGGG + Intergenic
967069593 3:185951074-185951096 ATCTTTAAACTGATTGAATTAGG - Intergenic
967083744 3:186074985-186075007 ACATTTATACTGCCTCTTTTGGG - Intronic
967712504 3:192725418-192725440 ACTTCTGAACTGATTCTTTTCGG + Intronic
969027305 4:4183748-4183770 AGATTTGAACTCATTTATTTTGG - Intergenic
970034264 4:11714559-11714581 ACATATATAATGATTCAATTAGG + Intergenic
970632047 4:17957896-17957918 AAATTTAACATGATTCATTCAGG - Intronic
970769438 4:19592959-19592981 ACATTTAACCTAAATCATCTGGG + Intergenic
971912741 4:32815736-32815758 TCATTTTAACGGTTTCATTTTGG - Intergenic
972956387 4:44397183-44397205 TTATAGAAACTGATTCATTTAGG - Intronic
973086287 4:46065683-46065705 ACAGTTAAACTCAGTCTTTTCGG + Intronic
973243027 4:47978580-47978602 AGTTTTAAATTGATCCATTTGGG + Intronic
974220152 4:58958288-58958310 AAAGTTAAACCAATTCATTTGGG + Intergenic
977102194 4:92831027-92831049 ACATTTAAACTGATATACCTTGG + Intronic
977610866 4:99029264-99029286 TCATTTAACCAGATTCCTTTTGG + Intronic
978106885 4:104913407-104913429 AAATTTTAACTGTTTCATTAGGG - Intergenic
978211014 4:106135008-106135030 AAATTAAACCTGCTTCATTTGGG - Intronic
978589225 4:110306296-110306318 TCATTTAAACTGATTTATGCAGG + Intergenic
979098857 4:116589529-116589551 ACATTTTAACTTCTTAATTTTGG + Intergenic
979428870 4:120602614-120602636 ACAATTAAGATTATTCATTTTGG + Intergenic
979938956 4:126735784-126735806 ACATTTAAAGGCTTTCATTTGGG + Intergenic
979994070 4:127409877-127409899 AAACTTAAACTCATTAATTTAGG + Intergenic
980221858 4:129928323-129928345 ATATTTAAAGTGCTTCCTTTAGG + Intergenic
980310374 4:131121343-131121365 GGATTTAAACTGTTGCATTTTGG - Intergenic
980478423 4:133351953-133351975 ACATTTTAAATGAATCATTCTGG - Intergenic
980504185 4:133693579-133693601 ACTTTTTAACTGTTTAATTTTGG - Intergenic
981327815 4:143471513-143471535 ACATTTATGCTTATTCATTTTGG + Exonic
982372718 4:154651561-154651583 ACTTTGAAACTGGTCCATTTTGG + Intronic
982974413 4:162035689-162035711 ACTTTTAAATAGAATCATTTTGG + Intronic
983486044 4:168332018-168332040 AAAGTTAGACTGATTCATTGAGG - Intergenic
984569267 4:181371885-181371907 ACATTCAAACTGATATATATAGG + Intergenic
985327788 4:188792048-188792070 ACATTGAAACAAATTTATTTTGG - Intergenic
986810234 5:11349875-11349897 ACATTTACACTGTTTCACTTTGG + Intronic
987667152 5:20958357-20958379 ACATTTAAAATGTTTAAATTTGG + Intergenic
987692243 5:21282083-21282105 ACAATAAAAATGATTGATTTAGG + Intergenic
988017018 5:25572305-25572327 ACATATCAACTGCTTCATCTGGG - Intergenic
988192209 5:27953103-27953125 ACATGTACACTGAATTATTTTGG - Intergenic
988926517 5:35995790-35995812 AATTTAAAACTGATTCATTTGGG - Intergenic
990058795 5:51620321-51620343 ACTTTTATATTTATTCATTTAGG + Intergenic
990089951 5:52030939-52030961 AAATATAATCTGTTTCATTTAGG + Intronic
990150895 5:52816198-52816220 AAATTTAAACTTAATCTTTTTGG + Intronic
990185927 5:53209013-53209035 ACATATTAACTGCTTCATCTGGG + Intergenic
990440319 5:55838217-55838239 ACAATTAAAGTGAAACATTTTGG - Intergenic
991060783 5:62373103-62373125 ATATTTAAACTTACACATTTGGG - Intronic
991172853 5:63648491-63648513 ACATTTATACAGGTTCATTTTGG + Intergenic
991328078 5:65460366-65460388 ATATTTAAAATGATTCTCTTTGG - Intronic
992770902 5:80046953-80046975 AAATTTCATCTGATTGATTTTGG - Intronic
992952656 5:81875869-81875891 AGATTTAAACAAATTCATTTTGG + Intergenic
992966416 5:82005587-82005609 ACATTTATAATTATTCTTTTTGG + Intronic
993488198 5:88513090-88513112 ACAATTAGAATGATTTATTTGGG - Intergenic
993593869 5:89828340-89828362 TCATTTGAATTGTTTCATTTAGG - Intergenic
993642674 5:90424541-90424563 ACATTTGAATTGTTTCAGTTTGG - Intergenic
993881482 5:93367059-93367081 ATTTTTAAACTGTTTTATTTAGG + Intergenic
994800172 5:104362949-104362971 CCTTTTAAACAGATACATTTTGG - Intergenic
995267070 5:110174556-110174578 ACATTTAAAGTTATTGCTTTGGG + Intergenic
995651208 5:114370587-114370609 ACATTTAAACTGAGACATAAAGG + Intronic
995709414 5:115020133-115020155 ACATTTACATTCTTTCATTTTGG - Intergenic
996446547 5:123559811-123559833 ACTTTTAAACAGTTTGATTTTGG + Intronic
996595985 5:125203456-125203478 GCATTTAACCTGAATCATTTGGG + Intergenic
996887355 5:128373245-128373267 AGATTTCAACAGAATCATTTAGG + Intronic
997079580 5:130722586-130722608 ACATCTAAACTGATGCTTTGAGG + Intergenic
999769277 5:154762927-154762949 TCACTTAAACTAATTTATTTAGG + Intronic
999979257 5:156942198-156942220 ACAGGTATAATGATTCATTTGGG + Intronic
1000472708 5:161665685-161665707 GCATTTGAATTGATTTATTTTGG + Intronic
1000695804 5:164381344-164381366 ACATTACAACTGATACATTAGGG - Intergenic
1000987584 5:167877287-167877309 ACATTTAAGATGACTCATTCTGG + Intronic
1001022202 5:168192535-168192557 AAATTTAAAATGTTTTATTTGGG - Intronic
1001333343 5:170777633-170777655 ACATTTAAGCTGATTCCTAGAGG - Intronic
1001976230 5:176001682-176001704 AAATTTAAAATGTTTTATTTTGG - Intronic
1002241193 5:177842089-177842111 AAATTTAAAATGTTTTATTTTGG + Intergenic
1003675059 6:8195465-8195487 ACATTTAACTTGGGTCATTTGGG + Intergenic
1003697386 6:8423839-8423861 GCATTTACACTGATGCATATGGG - Intronic
1003761661 6:9185340-9185362 ACCTTTAAACTGATTGAATCAGG + Intergenic
1004040611 6:11971326-11971348 GCCATTAAAATGATTCATTTGGG - Intergenic
1004059120 6:12174001-12174023 ACATTTGAATTTATTTATTTCGG + Intergenic
1005383898 6:25266599-25266621 TCATTTTAACTGAGTCATTCCGG - Intergenic
1005482481 6:26267979-26268001 AAATTTAATATGATCCATTTTGG - Intergenic
1006290933 6:33136128-33136150 AGATTTAAAATGATTATTTTAGG - Intergenic
1007512487 6:42384748-42384770 ACATTTGAACTGATGCGTATGGG - Intronic
1008259791 6:49350649-49350671 TCATTTAAAATGTTTCATTTTGG - Intergenic
1008336957 6:50318221-50318243 ATATTTAAAGTAATTCATTGTGG + Intergenic
1008717463 6:54306393-54306415 GCTGTTAAACTGATTCATGTTGG + Intergenic
1009521874 6:64693238-64693260 ACATTTGGACTGAATCAATTGGG - Intronic
1009556101 6:65169160-65169182 ACATGAAAACAGATTCATTATGG - Intronic
1009603192 6:65830521-65830543 AAACTTAAACTCATACATTTTGG - Intergenic
1010230495 6:73530527-73530549 ACATTTCAACTTATGAATTTTGG + Intergenic
1011035346 6:82968018-82968040 ACATTTGGGCTGATTCAGTTTGG + Intronic
1011831419 6:91376535-91376557 ACATTTTAACTTATACATTGAGG - Intergenic
1012422587 6:99080901-99080923 ACATTTGAAGTCATTCACTTTGG - Intergenic
1012932638 6:105332645-105332667 ACAGTAAAACTCATTAATTTGGG - Intronic
1013161014 6:107544920-107544942 ACATTAATACTAAATCATTTCGG + Intronic
1013636632 6:112035011-112035033 ATATTTAAAGTGTTTCTTTTAGG + Intergenic
1013829348 6:114254258-114254280 AAATTTAAACACATTCATTTGGG - Intronic
1014285779 6:119495725-119495747 TCATTTACAGTGATTCATTCAGG - Intergenic
1014603014 6:123439013-123439035 ACATTTAAAATATTTCCTTTAGG + Intronic
1015429705 6:133116457-133116479 ACTTTTTAACTGATTCTCTTAGG + Intergenic
1016157536 6:140830265-140830287 ACATTGAAATTGCTTCATTTGGG - Intergenic
1016492227 6:144618875-144618897 ATATTTAAAATGATATATTTAGG + Intronic
1016612303 6:146004572-146004594 GCATTTAAACTCATTCTTTGAGG + Intergenic
1016812215 6:148272429-148272451 ACATTTAGACTGATATATTCAGG + Intronic
1018590257 6:165411692-165411714 AAATACAAACTGAATCATTTAGG + Intronic
1018963375 6:168464789-168464811 ACAATTAAACAGAAGCATTTGGG + Intronic
1021003012 7:15357331-15357353 ACAGTTGAAATGACTCATTTAGG + Intronic
1021165010 7:17327146-17327168 ACATATAAAATGATAAATTTAGG + Intronic
1021262515 7:18475654-18475676 AAAAATAAACTAATTCATTTTGG - Intronic
1021507939 7:21405884-21405906 AGATTTAAACTGATCTGTTTGGG - Intergenic
1021687014 7:23196335-23196357 GCATTTAAACTGCTTCCTTCAGG - Intronic
1021847094 7:24774010-24774032 ACATTTACCCTGCTTCCTTTAGG + Intergenic
1022054262 7:26713216-26713238 ACATTTAAACTGAAGCCTTTTGG - Intronic
1022626466 7:32041946-32041968 AGCTTTAAGCTGCTTCATTTGGG + Intronic
1023781915 7:43663809-43663831 TCATTTAAATGGAATCATTTAGG + Intronic
1024326874 7:48115729-48115751 ACATTTAAATGGAGTCATTGGGG - Intergenic
1024390721 7:48808832-48808854 AAATTTGAACTGACTTATTTAGG - Intergenic
1025248866 7:57338270-57338292 ACATTTGAACTGGTTCAAATGGG + Intergenic
1026707624 7:72708798-72708820 ACTTTTAAACTAATTCTTTCAGG - Intronic
1027370244 7:77501621-77501643 ACATTTAAATCTTTTCATTTTGG - Intergenic
1027635584 7:80668520-80668542 ACATTTAGAATGTTTCTTTTGGG + Intronic
1027801855 7:82763141-82763163 ACAGTTGAACTGATTCATCGAGG + Intronic
1027998462 7:85458419-85458441 ACATTTAAAATATTTTATTTTGG - Intergenic
1028093108 7:86727736-86727758 ACATTTACACTCATACATATGGG - Intronic
1029141693 7:98415512-98415534 ACATTTAAATTTTTTCATTTTGG + Intergenic
1029837544 7:103328872-103328894 ACATTTAAAATTATTCAAATTGG - Intronic
1030127086 7:106164427-106164449 GCAATTAAACTGAATGATTTAGG + Intergenic
1030632930 7:111915168-111915190 TCATTGAAGCTGATGCATTTGGG - Intronic
1030963298 7:115954445-115954467 ACATATAACTTGATTTATTTTGG - Intronic
1031663830 7:124460478-124460500 AAATTTTAACTGAATCATTGAGG + Intergenic
1033921827 7:146403673-146403695 AGATTTAAACTATCTCATTTGGG - Intronic
1034301966 7:150024187-150024209 ACATTTAAATTCTTTCTTTTGGG + Intergenic
1034727257 7:153348582-153348604 ACATTTTAAAAGAATCATTTAGG - Intergenic
1034804081 7:154073128-154073150 ACATTTAAATTCTTTCTTTTGGG - Intronic
1035320092 7:158023101-158023123 AGTTTTAAACTCATTCATCTTGG + Intronic
1035854073 8:2954659-2954681 ACGTATAAATTGATTGATTTGGG - Intronic
1036409405 8:8485000-8485022 ACTTTTTAACTGATTGACTTAGG - Intergenic
1038154379 8:24974203-24974225 ACATTTAATCAGATTTACTTTGG + Intergenic
1040416072 8:47197177-47197199 ACATTTAATTTTATTTATTTTGG + Intergenic
1040706058 8:50129094-50129116 AGCATTAAACTGATTTATTTAGG + Intronic
1040799797 8:51328018-51328040 ACATTTAAACTGGTGAATTCTGG + Intronic
1040856652 8:51955434-51955456 AAATTTAAACAGATTCTTTAAGG + Intergenic
1041385454 8:57297589-57297611 ACAGTAAAACTGGTTCATTCTGG - Intergenic
1042906980 8:73781822-73781844 ACATTTAAAGTGTGTGATTTTGG + Intronic
1043959041 8:86394380-86394402 ACATTTAAACTAAGTGATTAAGG - Intronic
1043982909 8:86661081-86661103 ACATTTTTACTGACTCATATGGG - Intronic
1044012889 8:87016872-87016894 ACATGTCAACTGCTTCATCTGGG - Intronic
1044219651 8:89654745-89654767 ACCTGTAAACTCATTGATTTGGG + Intergenic
1044481034 8:92688322-92688344 ACATTTTAACTGCTTTATCTAGG - Intergenic
1044484783 8:92739136-92739158 ACTATTAAACTGATGCCTTTGGG - Intergenic
1044548918 8:93490414-93490436 ACATTTAGAATTATTCATTAAGG - Intergenic
1045934923 8:107668379-107668401 CCAGCTAAACTGAATCATTTAGG - Intergenic
1046584873 8:116138993-116139015 AGATTTAAACATATTCCTTTGGG - Intergenic
1046690686 8:117281237-117281259 AAATTTAAACAGATTAATTATGG - Intergenic
1047108518 8:121762033-121762055 AAATTTAAACTCCTTCCTTTAGG - Intergenic
1047841551 8:128759299-128759321 ACTTTCAAACTCATTCCTTTAGG + Intergenic
1047900524 8:129416619-129416641 ACATTTGAACTGAGTCATAAAGG + Intergenic
1048829232 8:138459871-138459893 GGATTTAAACTGATGCATTCTGG - Intronic
1049900680 9:160840-160862 ACATTCAAAATGAATAATTTGGG + Intronic
1049949065 9:626955-626977 ACATTCTAACTCATTCCTTTTGG + Intronic
1050411715 9:5373162-5373184 AGATTTAAACGGAATAATTTGGG - Intronic
1050625971 9:7504021-7504043 ACATGTAAAATGTTTCATTTTGG + Intergenic
1050859106 9:10401927-10401949 ACATTTAAACTTTTTATTTTGGG - Intronic
1050918188 9:11163748-11163770 AAATTTAAACTGGCTTATTTGGG + Intergenic
1050993277 9:12179616-12179638 ACATTAAAACTGACACATCTTGG - Intergenic
1051041477 9:12817586-12817608 ACATTTAAACTCAGACCTTTAGG + Intronic
1051190937 9:14511973-14511995 ACAATTAAACTGTTTTATTTAGG + Intergenic
1053743719 9:41171123-41171145 ACATTCAAAATGAATAATTTGGG + Intronic
1054164495 9:61709233-61709255 AAAGTCAAATTGATTCATTTGGG + Intergenic
1054348995 9:64000940-64000962 ACATTCAAAATGAATAATTTGGG + Intergenic
1054483552 9:65694183-65694205 ACATTCAAAATGAATAATTTGGG - Intronic
1054684624 9:68260135-68260157 ACATTCAAAATGAATAATTTGGG - Intronic
1055540666 9:77301885-77301907 ACATTTTAACTCACTGATTTAGG - Intronic
1058113849 9:101062568-101062590 TGATTTAAACTGCTACATTTAGG + Intronic
1058206988 9:102120267-102120289 GAATTTAAACTCATTCATTATGG - Intergenic
1058421589 9:104837967-104837989 ACATTTAAACTGACTCTTGAGGG + Intronic
1058860165 9:109108983-109109005 TCTTTTAACCTGATTCTTTTTGG - Intronic
1059078794 9:111224745-111224767 ACATTTGATTTGATTCAATTAGG - Intergenic
1059910847 9:119042500-119042522 ACATTTAAGTTGTTTCATTTTGG + Intergenic
1060844538 9:126825653-126825675 ACATCTAAATGGACTCATTTAGG + Intronic
1062125951 9:134862997-134863019 AAATTTAAACATATTAATTTTGG - Intergenic
1185847197 X:3448877-3448899 ATATTTAAACCAATGCATTTGGG + Intergenic
1186390883 X:9158062-9158084 ACATTTAAACTGATCATATTTGG + Intronic
1186416214 X:9385080-9385102 ACAGTGAAATTGATTCATTTTGG - Intergenic
1186491230 X:9974391-9974413 ATAGTTAAATTTATTCATTTTGG + Intergenic
1186658082 X:11637815-11637837 TCAATTAAAATGATTCTTTTGGG + Intronic
1187263938 X:17713578-17713600 ACATTTTAACAGATGTATTTTGG + Intronic
1187856482 X:23641431-23641453 ATTTTTAAACTGAGTTATTTGGG - Intergenic
1188340990 X:29001822-29001844 ACATTTAAATTGCTTCAGTTTGG - Intronic
1188513476 X:30961017-30961039 ACATTTAAACTGGATAATTGAGG + Intronic
1188900455 X:35726345-35726367 ACAATTAAACTGTTTTAATTTGG + Intergenic
1189128705 X:38476023-38476045 ACATATAATCTTATTCTTTTGGG - Intronic
1189192186 X:39119838-39119860 ACATTAAAAATGAGTTATTTGGG + Intergenic
1189683001 X:43536156-43536178 TCATTTAAACTGAATCAATCCGG - Intergenic
1189836471 X:45028231-45028253 ACATTTAAAATGCTTCACTGAGG + Intronic
1190401229 X:50037238-50037260 AGATTTAACCTGATTTATTAAGG - Intronic
1190846604 X:54198310-54198332 CCATCTACTCTGATTCATTTAGG + Exonic
1191159126 X:57309175-57309197 ACATTTAAACTGTGTTCTTTTGG + Intronic
1192603322 X:72487528-72487550 ACATGTAAAGTGATCCATTTAGG + Intronic
1192603329 X:72487565-72487587 ACATGTAAGGTGATCCATTTAGG + Intronic
1192616555 X:72629602-72629624 ATATTTGAACTGATGTATTTAGG + Intronic
1192803286 X:74487358-74487380 ACATATTAACTGCTTCATCTGGG + Intronic
1193834435 X:86324026-86324048 ACAATAAAGCTGCTTCATTTTGG - Intronic
1194074827 X:89377278-89377300 ACATTAAAATTTATTCTTTTTGG + Intergenic
1194131759 X:90090370-90090392 ACATATCAACTGCTTCATCTGGG - Intergenic
1194721749 X:97348478-97348500 ACATTGAAGATGATTCATTTAGG - Intronic
1194915194 X:99698409-99698431 ACATTTTTCCTGATTTATTTTGG - Intergenic
1196122090 X:112062119-112062141 ACTTTTACTCTGCTTCATTTAGG + Intronic
1196814761 X:119656223-119656245 ACAATAATACTTATTCATTTCGG + Intronic
1196945930 X:120826291-120826313 ACATTTAAACTGAGTCTTAAAGG + Intergenic
1197673753 X:129307982-129308004 ACATTTAATCTCAGTCATTGTGG - Intergenic
1197854530 X:130901149-130901171 AAATTTTAAGTGAATCATTTGGG + Intronic
1198969206 X:142262312-142262334 AAAATTAAACTGCTTCAATTAGG - Intergenic
1199150527 X:144479967-144479989 ACCCTTCAACTGATTTATTTAGG - Intergenic
1199242600 X:145565140-145565162 ACATTTAAAATAATTATTTTGGG + Intergenic
1200730424 Y:6731448-6731470 ACATTAAAATTTATTCTTTTTGG + Intergenic
1200817299 Y:7546914-7546936 ACATTTAAAAGAATGCATTTGGG - Intergenic
1201270728 Y:12251392-12251414 ACATTTGTACTGAAGCATTTTGG - Intergenic
1202086076 Y:21138251-21138273 GCATGTTAACTGCTTCATTTGGG + Intergenic