ID: 1064424800

View in Genome Browser
Species Human (GRCh38)
Location 10:15221183-15221205
Sequence AGATGGCCAAAGTGTCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064424798_1064424800 -8 Left 1064424798 10:15221168-15221190 CCTATAAGATAACCAAGATGGCC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1064424800 10:15221183-15221205 AGATGGCCAAAGTGTCATCTAGG 0: 1
1: 0
2: 1
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064424800 Original CRISPR AGATGGCCAAAGTGTCATCT AGG Intronic
901781621 1:11598245-11598267 TGAAGGCCAAAGTGTCAGCAGGG + Intergenic
902866271 1:19282007-19282029 ATAAGGCCAAAGTCTCATCTGGG - Intergenic
903620747 1:24696266-24696288 AGATGACTTGAGTGTCATCTGGG - Intergenic
903666141 1:25008880-25008902 AGATGCCCAGAGTCTGATCTGGG - Intergenic
903791658 1:25897410-25897432 AGGTAGCCAAACTGTCATCTGGG + Intronic
904548297 1:31294334-31294356 GAATTGCCCAAGTGTCATCTTGG - Intronic
907099798 1:51819844-51819866 AAATGGCCAAAGTTTGGTCTGGG + Exonic
908432820 1:64075350-64075372 AGATCACCACAGTGTGATCTGGG + Intronic
911051995 1:93679504-93679526 AGATGGCCAGAGTCTCACCTGGG - Intronic
911858101 1:102907888-102907910 ATATGTGCAAAATGTCATCTAGG + Intronic
915161486 1:153923350-153923372 AGATGGCCAAAGGGGAATCCCGG - Intergenic
916014044 1:160732742-160732764 AGATAGCCATATGGTCATCTGGG + Intergenic
919835299 1:201569147-201569169 AGCTGACCAAAGTCTCATCCAGG + Intergenic
920320169 1:205114853-205114875 TGATGGCCGAATTGTCATCTGGG - Exonic
921951480 1:220934719-220934741 AGCTTGCCAAACTGTCCTCTTGG - Intergenic
923439684 1:234005184-234005206 AGATCTGCAAAATGTCATCTAGG - Intronic
924062002 1:240184891-240184913 AAATGGCGAAAGTGTCCTTTAGG - Intronic
1064424800 10:15221183-15221205 AGATGGCCAAAGTGTCATCTAGG + Intronic
1066286008 10:33966731-33966753 ATATGGTTAAAATGTCATCTAGG - Intergenic
1069555525 10:69395188-69395210 AAATGGCCAAAATGTCCCCTAGG - Intronic
1071218374 10:83433755-83433777 ATGTGACCAAAATGTCATCTAGG - Intergenic
1073206350 10:101771336-101771358 AGAAGGCCACAGGGCCATCTTGG - Intronic
1079315637 11:19405875-19405897 AAAATGCCAAAGTGTTATCTAGG + Intronic
1080799138 11:35593292-35593314 AGTTGGCTGAAGTGTCAGCTGGG - Intergenic
1084130777 11:67132610-67132632 ATTTGGCCAAAGTGGCATTTTGG + Intronic
1086389247 11:86344664-86344686 AGATGGGCTTGGTGTCATCTGGG - Exonic
1086576210 11:88341467-88341489 AAAAGTCTAAAGTGTCATCTGGG + Intergenic
1089914898 11:122144266-122144288 AAATGGCCATAGTATCTTCTAGG - Intergenic
1090332860 11:125944906-125944928 AGAGTGCCACAGTGACATCTTGG + Intergenic
1090476569 11:127027235-127027257 AGGTGGCCAAAGGGTAGTCTTGG + Intergenic
1095641256 12:44487618-44487640 AGATTATCAAAGTGTGATCTAGG + Intergenic
1096272998 12:50181320-50181342 AGCTGGAGAAAGTGACATCTTGG + Intronic
1100021395 12:90073683-90073705 AGATTGGCAAAATGTCAGCTTGG + Intergenic
1100100965 12:91105210-91105232 AGATGGGCATAGTCCCATCTTGG + Intronic
1102847469 12:116202058-116202080 AGATGGCTATATTGTCTTCTAGG - Intronic
1105264795 13:18806168-18806190 CAAAGTCCAAAGTGTCATCTGGG + Intergenic
1106960231 13:34989767-34989789 CGAAGTCCAAAGTTTCATCTGGG + Intronic
1108297389 13:49037903-49037925 AGATGGCTTAAGTGCCTTCTTGG + Intronic
1112055377 13:95685477-95685499 AAAAGTCCAAAGTCTCATCTGGG - Intronic
1117438152 14:55737207-55737229 AGATGGCCAAAGTGACTTGCAGG - Intergenic
1117946794 14:61034863-61034885 AGAAGGGAAAAGTGTCATCATGG + Intronic
1121089519 14:91171458-91171480 AGATGGCCAGACAGCCATCTGGG + Intronic
1121332471 14:93058222-93058244 TGATGGCCACAGGGGCATCTGGG + Intronic
1122077069 14:99242830-99242852 AGAGGGCCTAAGTGTCCTATTGG - Intronic
1123807459 15:23889306-23889328 AGAGGGCCAAAGCGTCTACTGGG + Intergenic
1123820032 15:24019608-24019630 AGTTAACCAAAGTCTCATCTTGG - Intergenic
1127136436 15:55928356-55928378 AGATGGCTTAAATGTCTTCTAGG - Intronic
1127838725 15:62811596-62811618 ACATGGCCACTGTGTTATCTGGG + Intronic
1128332169 15:66763065-66763087 AGATGTCCAAAGTGCCCTCAAGG + Intronic
1128981529 15:72191059-72191081 AGGTGGCCAATGAGTCATTTCGG - Intronic
1133838465 16:9387116-9387138 AGATGGTGAAGGTGTCAGCTTGG - Intergenic
1134026751 16:10959938-10959960 AGATGGACAGGGTGTCATCTTGG - Intronic
1134220012 16:12346469-12346491 AGTTGCCCAAAGTCACATCTAGG + Intronic
1135142438 16:19933154-19933176 ACATGGCCAAAATGTCCCCTTGG - Intergenic
1135381156 16:21997263-21997285 AGAGGGCCAAAGTCTCATCTGGG + Intronic
1135495009 16:22943720-22943742 AGATAGCCAAAGTGTCTCCTGGG + Intergenic
1137236065 16:46619432-46619454 AGATGACCAAAGTGTACTCAAGG + Intronic
1137961878 16:52889344-52889366 AAATGGTCCAAGTGTCATCTGGG - Intergenic
1140580603 16:76226819-76226841 AAATTGCCAAAATGTCTTCTGGG + Intergenic
1140924985 16:79573887-79573909 AGATTGCAAAGATGTCATCTTGG + Intergenic
1148357787 17:46987322-46987344 AGATGGCTAAAGAGGCATGTGGG + Intronic
1151386698 17:73759453-73759475 AGATGGTCACCGTGTCATCATGG - Intergenic
1152140555 17:78534071-78534093 AGATAGCAAAAGGCTCATCTGGG + Intronic
1155234482 18:23805671-23805693 AGAGGGCCACAGTGACATTTTGG + Intronic
1157292725 18:46421567-46421589 AGATGGGGAAAGTATCTTCTTGG + Intronic
1157808810 18:50678732-50678754 AGAGGGCAAACGTGTTATCTTGG - Intronic
1160106983 18:75987413-75987435 GCATGGCCTAAGTGTCATCCGGG - Intergenic
1162466152 19:10842140-10842162 AGATGGGCTTGGTGTCATCTGGG - Intronic
1168543867 19:57234106-57234128 AGATTGCAATAGTGTGATCTCGG + Intronic
926117632 2:10223507-10223529 AGAGGGCCAAAGTCTCAGGTGGG - Intergenic
927807496 2:26161041-26161063 AGATGGACTTGGTGTCATCTGGG - Intergenic
928676994 2:33660159-33660181 AGATCGCCAAACTCTCATTTGGG - Intergenic
930073701 2:47389923-47389945 GGATGGCCACAGGGTCATGTAGG - Intergenic
931629772 2:64288389-64288411 AGATGGCCAACCTGTCATAAGGG - Intergenic
931656846 2:64517307-64517329 AGAGGTCCAAAATGTCATCAGGG + Intergenic
932482349 2:72052215-72052237 AGATGGTCAAATAGTCCTCTAGG + Intergenic
935798432 2:106668393-106668415 ACATGGCAGGAGTGTCATCTGGG - Intergenic
935882134 2:107575459-107575481 AGATGGCCAAGGTGTAAACCCGG + Intergenic
937661122 2:124430682-124430704 AGGTGGCAAAAGTGAAATCTGGG + Intronic
938989323 2:136611777-136611799 AGATGGCAGAAGTGCAATCTTGG - Intergenic
940128908 2:150359297-150359319 TGAGGGCAAAAGTGTCCTCTGGG + Intergenic
941589397 2:167400731-167400753 AGATGGCCAAATTGTCACACAGG - Intergenic
945678992 2:212890266-212890288 ATATTGCCAAAGTCTCATTTAGG - Intergenic
946226213 2:218265415-218265437 AGATGGCCAAGGTCCCATCCAGG + Exonic
946507393 2:220316557-220316579 AGATGGCCAAAGAGTCATTAAGG - Intergenic
948251442 2:236533254-236533276 AGATGTACAACGTGTCATATGGG - Intergenic
1169070775 20:2728552-2728574 AGATTGCCACTGTGTCACCTAGG - Intronic
1169566513 20:6859062-6859084 ATATGGCCAGAGTGACTTCTGGG - Intergenic
1169777881 20:9276056-9276078 GGATGGCAAATGTGTCACCTAGG + Intronic
1170984766 20:21247426-21247448 ACATGGCCAAAGAATGATCTTGG + Intergenic
1173108626 20:40163035-40163057 AGATTTGCAAAGTCTCATCTGGG - Intergenic
1173141580 20:40489619-40489641 AGATGGCTAAAGTGACATGTGGG - Intergenic
1173560868 20:44004455-44004477 AGATGGGCAAACAGTCATCTGGG - Intronic
1176849873 21:13904622-13904644 CAAGGTCCAAAGTGTCATCTGGG + Intergenic
1177098169 21:16865562-16865584 AGGTGGCCAAAGTCTCTTCCAGG + Intergenic
1177666046 21:24161006-24161028 AAATAGCTAAACTGTCATCTAGG - Intergenic
1177866545 21:26519376-26519398 AGTTGGCCAAAGAGACATCTGGG + Intronic
1177914507 21:27072000-27072022 AGATGGGAAAAGGGTCATGTTGG - Intergenic
1179169684 21:38963154-38963176 ACAAGACCAAAGTGTCAGCTGGG - Intergenic
1183160280 22:36108708-36108730 AAAAGGCTGAAGTGTCATCTGGG - Intergenic
1183647550 22:39135171-39135193 AGAGGGCCAAGGTGTGCTCTTGG + Intronic
950277423 3:11674510-11674532 AGATGGGGAAAGAGTCAGCTAGG + Intronic
952662349 3:35866874-35866896 AGATGATCACAGTGTCAGCTGGG + Intergenic
953867274 3:46595296-46595318 TGATGAACAAAGTGTCATCAGGG - Intronic
954154638 3:48678719-48678741 AGATGCGCACAGGGTCATCTAGG + Exonic
955542527 3:59993057-59993079 AGATGGCCTAAGTGAAATATTGG - Intronic
958876970 3:99627561-99627583 AGCGGGCCAAGGGGTCATCTTGG - Intergenic
960463146 3:117961653-117961675 AGAGGGGCTAAATGTCATCTAGG - Intergenic
960493492 3:118347372-118347394 TGATGGCTAAAGTGTAGTCTTGG - Intergenic
966683603 3:182670140-182670162 AGTTGGGCAAAGTGTGTTCTAGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969911380 4:10449912-10449934 AAATGGCAAAAGTGCCTTCTGGG - Intronic
975739882 4:77419532-77419554 AGAGAGCCATAGTGTCATCCTGG + Intronic
975773397 4:77755772-77755794 ATATAGCCAAAATGTCATCATGG + Intronic
976603743 4:86963365-86963387 TGATGTCAAAAGTGTCAACTAGG + Intronic
977104518 4:92864414-92864436 AGATGGCAGTACTGTCATCTTGG - Intronic
977227383 4:94409178-94409200 AGATTGCCAATGTCTTATCTAGG - Intergenic
981674883 4:147331017-147331039 TGATGGCCAAAATGTCACCTAGG + Intergenic
982197470 4:152930885-152930907 AGATGGGCAAAGGGACATGTTGG - Intergenic
983310380 4:166052868-166052890 AGATGGCCAAAGGCTGTTCTTGG - Intronic
983455165 4:167953805-167953827 CCATGTCCAAAGTCTCATCTGGG - Intergenic
983829928 4:172313700-172313722 ATATGGCCAAAATATAATCTGGG + Intronic
986001847 5:3636780-3636802 ACATGTCCAAGGTGTCACCTAGG - Intergenic
992301757 5:75389212-75389234 AGAGAAACAAAGTGTCATCTAGG + Intronic
992614023 5:78532729-78532751 AGATGGAAAAAGTGGCATCTCGG - Intronic
994529052 5:100943546-100943568 AGATAGCCAAAGTGTGAACTAGG - Intergenic
995424761 5:112008192-112008214 AGTTGGCAAAAGTATCATCTGGG - Intergenic
998979007 5:147679865-147679887 AGGTGGCAAAGGTGTCAGCTGGG + Intronic
999777108 5:154820292-154820314 AGACAGCCTAAGTGTCATCCTGG - Exonic
1002706131 5:181161684-181161706 AAATGCCCACAGTGTCTTCTGGG - Intergenic
1003066972 6:2912096-2912118 TGCTGGCAAAAGTGCCATCTGGG + Intergenic
1010819488 6:80396417-80396439 CCAAGTCCAAAGTGTCATCTGGG - Intergenic
1013176620 6:107683295-107683317 AGATGGCCACAGTGACATGTTGG - Intergenic
1014948195 6:127521197-127521219 AGAAGGCTAAAGTCTCAACTTGG + Intronic
1019864776 7:3697584-3697606 AGATGGTCAAAGAATCATGTGGG - Intronic
1020223749 7:6263081-6263103 AGATGGACATACTGTCAGCTTGG - Intronic
1028068285 7:86415661-86415683 AGAGAAGCAAAGTGTCATCTTGG + Intergenic
1028216205 7:88136647-88136669 AGATGGTCAAAGTTTAAACTAGG - Intronic
1032980153 7:137272461-137272483 AGATAGCGATACTGTCATCTTGG - Intronic
1036025326 8:4901131-4901153 GCATGTTCAAAGTGTCATCTGGG + Intronic
1039742083 8:40392214-40392236 AGAAGGCCAACATGGCATCTGGG - Intergenic
1042384895 8:68162797-68162819 AGATGGCCACAGTGAGGTCTGGG - Intronic
1042631677 8:70823764-70823786 AGATGGCCAAGGTGTCAGGGTGG + Intergenic
1043385883 8:79747523-79747545 AAATGGCTAAAGAGTCATATGGG - Intergenic
1046217598 8:111169952-111169974 ATGTGGACAAAGTGCCATCTTGG + Intergenic
1050280488 9:4045167-4045189 ATATGGCCAAAATGGCAACTTGG - Intronic
1051256315 9:15217366-15217388 AGCTGGCCACACTGTCACCTGGG + Intronic
1051497575 9:17741903-17741925 TGATGGAGAAGGTGTCATCTGGG + Intronic
1051860041 9:21614348-21614370 TCCTGGACAAAGTGTCATCTTGG + Intergenic
1051925638 9:22321596-22321618 AGATTGCCAAACTGCCTTCTTGG - Intergenic
1051969706 9:22873201-22873223 AAATGGCCAAACTGTCATCCAGG - Intergenic
1054803195 9:69373201-69373223 ACATGGCCAAATTGTTATCCAGG - Intronic
1054963542 9:70996390-70996412 AGATGGGCATAGTGACACCTTGG - Intronic
1055877076 9:80955980-80956002 AGATGGTCAAAGTGAAATATTGG + Intergenic
1057560384 9:96123635-96123657 AGGTGGCCCAAGTGTGTTCTTGG - Intergenic
1059426398 9:114223420-114223442 AGATGGCCACGGGGACATCTGGG - Intronic
1185974437 X:4703577-4703599 AGATGGCAAAAATGTTGTCTGGG - Intergenic
1186515353 X:10162816-10162838 TGATCTTCAAAGTGTCATCTGGG - Intronic
1186577608 X:10783208-10783230 AGACAGCCACAGTGTCATCTTGG + Intronic
1187387608 X:18862645-18862667 AGAGGGCCAAGGGGGCATCTTGG - Intergenic
1187788028 X:22915407-22915429 AGATTCCAAAAGTGTCATCAAGG + Intergenic
1188364300 X:29295737-29295759 TGATGGACAGAGTTTCATCTTGG - Intronic
1188937006 X:36188859-36188881 AGTTGTCCAAAGGGTCATCAAGG - Intergenic
1190477154 X:50839809-50839831 AGATGGCCACAGTGTGGACTTGG + Intergenic
1193478268 X:81994636-81994658 AGATGGCCACAGTGGAAACTGGG - Intergenic
1195748456 X:108141603-108141625 TGAAGGCCAGAGTGTCATCCTGG - Intronic
1198542198 X:137652005-137652027 AGATGGCCATAGTGTCATGAAGG + Intergenic
1199999802 X:153053827-153053849 ACATTGCCAAATTGTCTTCTGGG - Intergenic
1200928188 Y:8673314-8673336 AGATTGTCATAGTGTCATTTTGG + Intergenic
1202034916 Y:20622479-20622501 AGATGACCAAAGTTTCTTTTTGG - Intergenic