ID: 1064426861

View in Genome Browser
Species Human (GRCh38)
Location 10:15237077-15237099
Sequence AAGAGGGCCTTGAGGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064426856_1064426861 -6 Left 1064426856 10:15237060-15237082 CCAAATAGCAGCAAACTAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 144
Right 1064426861 10:15237077-15237099 AAGAGGGCCTTGAGGCTCCTGGG No data
1064426855_1064426861 -1 Left 1064426855 10:15237055-15237077 CCAGGCCAAATAGCAGCAAACTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1064426861 10:15237077-15237099 AAGAGGGCCTTGAGGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064426861 Original CRISPR AAGAGGGCCTTGAGGCTCCT GGG Intronic
No off target data available for this crispr