ID: 1064441040

View in Genome Browser
Species Human (GRCh38)
Location 10:15353942-15353964
Sequence CAGATGAGCGTGCATGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064441040_1064441042 17 Left 1064441040 10:15353942-15353964 CCGTGGGCATGCACGCTCATCTG No data
Right 1064441042 10:15353982-15354004 TAAGCTTTAACACAATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064441040 Original CRISPR CAGATGAGCGTGCATGCCCA CGG (reversed) Intronic