ID: 1064441040

View in Genome Browser
Species Human (GRCh38)
Location 10:15353942-15353964
Sequence CAGATGAGCGTGCATGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064441040_1064441042 17 Left 1064441040 10:15353942-15353964 CCGTGGGCATGCACGCTCATCTG 0: 1
1: 0
2: 2
3: 7
4: 130
Right 1064441042 10:15353982-15354004 TAAGCTTTAACACAATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064441040 Original CRISPR CAGATGAGCGTGCATGCCCA CGG (reversed) Intronic
901740258 1:11337661-11337683 GAGATGAGAGTGCCTGCCCCTGG - Intergenic
903056921 1:20642440-20642462 CAGATAACTGTGCATGTCCAAGG - Intronic
903978178 1:27165637-27165659 CATATGAGAGGGCAAGCCCACGG - Intronic
911085282 1:93972086-93972108 AAAATGATTGTGCATGCCCAGGG - Intergenic
914453282 1:147812068-147812090 CAGATGAACTTGCAGGACCAAGG + Intergenic
916199069 1:162252412-162252434 GAGATAACTGTGCATGCCCAAGG - Intronic
918202481 1:182280121-182280143 CAGCTGAGCGGGCTTGCTCATGG + Intergenic
1063306680 10:4909225-4909247 CAGATGAGGGAACCTGCCCAGGG + Intergenic
1064174932 10:13066689-13066711 CAGATGAGGGAACCTGCCCAGGG + Intronic
1064175620 10:13072497-13072519 CAGATGAGGGAACATGCCCAGGG + Intronic
1064441040 10:15353942-15353964 CAGATGAGCGTGCATGCCCACGG - Intronic
1065464924 10:26009434-26009456 CAAATGAGAGAGCAGGCCCAAGG + Intronic
1065811079 10:29444358-29444380 CAGATGAGGGAACTTGCCCAGGG - Intergenic
1066102777 10:32132603-32132625 CAGATGAGGGAACCTGCCCAGGG - Intergenic
1069823246 10:71240191-71240213 CAGAAGAGTGAGCATGCCCATGG - Intronic
1073953492 10:108839131-108839153 CAGATGAGGGAACCTGCCCAGGG - Intergenic
1074704778 10:116121020-116121042 AACATGAGGGAGCATGCCCAAGG + Intronic
1076500590 10:130933289-130933311 CAGGTGAGCGTGGATGCGGAGGG + Intergenic
1078088518 11:8249132-8249154 CAGATGAGCTCCCATTCCCAAGG + Intronic
1080192486 11:29568845-29568867 CAGCTGGGCGTTCATGCCCAGGG - Intergenic
1082966046 11:58967014-58967036 CACGTGAGGGTGAATGCCCACGG - Intronic
1084110816 11:67013298-67013320 CACAAGAGCTTGCATGGCCAGGG - Intronic
1085462021 11:76699926-76699948 CAGATGAGGATGCAGGCACAGGG - Intergenic
1086274561 11:85110477-85110499 CAGAGGAGAGTGCATGCTTAGGG - Intronic
1090204055 11:124875258-124875280 CAGATCAAGGTGCAAGCCCAAGG + Exonic
1091691319 12:2599333-2599355 CAGATGACCGTGGCTGTCCAAGG + Intronic
1092905833 12:13099947-13099969 CTGATGACCATGCATGCCCCTGG + Intronic
1100518592 12:95351953-95351975 CAGATGAGAGAACATGGCCACGG + Intergenic
1101775417 12:107788917-107788939 CAGATGAGAGAACCTGCCCAGGG - Intergenic
1103192989 12:119018293-119018315 GAGATAACTGTGCATGCCCAAGG - Intronic
1103985897 12:124767292-124767314 CTGATTTGCATGCATGCCCATGG + Intergenic
1107350222 13:39506431-39506453 CAGAAGAGCGTGAAATCCCATGG - Intronic
1109638515 13:65154724-65154746 GAGATAATTGTGCATGCCCAAGG + Intergenic
1113092249 13:106628139-106628161 CAGGTGAGCATGTAGGCCCAGGG + Intergenic
1113972901 13:114203782-114203804 CAGATGAGGGAACCTGCCCAGGG - Intergenic
1118719879 14:68586430-68586452 CACATGAGCTTGCATTTCCATGG - Intronic
1121332454 14:93058150-93058172 CTGATGGGCTTGCAGGCCCAGGG - Intronic
1128738298 15:70066057-70066079 CAGATGGGCCTGGCTGCCCAGGG + Exonic
1130285639 15:82552242-82552264 CACATGCGCATGCCTGCCCATGG - Intronic
1134233069 16:12444435-12444457 CAGATGAGGCTGCAGGCTCAGGG - Intronic
1134316615 16:13124570-13124592 CAGATCATGGTGGATGCCCATGG - Intronic
1135788077 16:25368330-25368352 CAGATGAGCGAACTTGCTCAGGG + Intergenic
1141441565 16:84032849-84032871 CACATGTGCGTGCATGGGCACGG + Intronic
1144949716 17:18987414-18987436 CAGATGAGCGTGCGTGATGACGG - Intronic
1146292675 17:31621843-31621865 CAGGACAGTGTGCATGCCCAGGG - Intergenic
1148511880 17:48177991-48178013 CAGATGAGTCTTCATGCCCTTGG + Intronic
1149300857 17:55303723-55303745 GAGATAACCGTGCATGCCCAAGG - Intronic
1150794840 17:68228968-68228990 CAGAAGGGCGTGCATGCAGAGGG - Intergenic
1152525761 17:80887473-80887495 CAGAGCACCGTGCCTGCCCATGG - Intronic
1154247600 18:12713520-12713542 GAGATAACTGTGCATGCCCAAGG - Intronic
1154339124 18:13488699-13488721 CACGTGAGCGTGCATGTGCAGGG - Intronic
1156512306 18:37648618-37648640 CAGATGAACATCAATGCCCAAGG - Intergenic
1156673657 18:39501455-39501477 CTAATGAGTATGCATGCCCATGG - Intergenic
1156782382 18:40866370-40866392 CAGATGAGGGAGCCTGTCCAGGG + Intergenic
1158046652 18:53163846-53163868 CAGAGGAAAGTCCATGCCCAAGG + Intronic
1158425985 18:57340019-57340041 GAAATGAGAGTCCATGCCCAGGG - Intergenic
1159852142 18:73536660-73536682 CAGAAGAGAGTGGATGCCAAAGG + Intergenic
1160985366 19:1836108-1836130 GAGAGGAGAGTGGATGCCCAGGG - Intronic
1161168448 19:2801147-2801169 CAGATAACTGTGCGTGCCCAAGG - Intronic
1161226538 19:3149398-3149420 CACATGTGCGTGCATGTGCATGG - Intronic
1161768299 19:6218568-6218590 CTGAAGAGCGTGCGTGCACAGGG + Intronic
1162811737 19:13168156-13168178 AAGCTGAGGGTGCATGCCCCTGG + Intergenic
1163723176 19:18907820-18907842 CAGATGCGCGTGGATGCTTACGG - Intronic
1164558432 19:29270927-29270949 CAGATGAGAATGCAGGCCCGGGG - Intergenic
1164636223 19:29793292-29793314 CTAATGAGCATGCAGGCCCATGG - Intergenic
1167623696 19:50572832-50572854 CAGCTGAGCGTGGTGGCCCATGG - Intergenic
928260166 2:29759403-29759425 CACATGCACTTGCATGCCCAGGG - Intronic
932327562 2:70873106-70873128 CACCTGAGAGTGCCTGCCCAGGG + Intergenic
933303259 2:80566793-80566815 AAGATCAGTGTGCATGCCAAAGG + Intronic
935129801 2:100253244-100253266 CAGATGGGCGTTCCAGCCCAGGG + Intergenic
936058395 2:109278737-109278759 CAGATGGGCTTGCATCCCTAGGG - Intronic
937991109 2:127663048-127663070 CACATGCGCATGCATGCTCAGGG + Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944325385 2:198398262-198398284 CAGATGAGTTTGAATGCTCAGGG + Intronic
946425435 2:219592933-219592955 CTGATGAGCGTGCCTGGTCATGG + Intergenic
946529621 2:220557756-220557778 CATATGAGCGGGCATGCCCACGG - Intergenic
948044189 2:234930227-234930249 CAGATGAGCATGCATGCACAGGG + Intergenic
1170947014 20:20900534-20900556 CAGATGAGGGAACTTGCCCAGGG - Intergenic
1173932615 20:46833180-46833202 CAGATGAGTTTGCTTGGCCATGG - Intergenic
1179959434 21:44759727-44759749 CAGATGACCATCCCTGCCCAGGG + Intergenic
1181896219 22:26110165-26110187 CAGATAGGGGTGCATGCCCAGGG + Intergenic
953109508 3:39919953-39919975 AAGATGAAGGTACATGCCCAAGG - Intronic
953274083 3:41477771-41477793 CAGAAGAGGCTGCATGCCCTTGG - Intronic
953805179 3:46062238-46062260 CAGCTGAGCGGGCATGTCCATGG - Intergenic
955662348 3:61314742-61314764 CAGAGGAGCTGGCTTGCCCAGGG - Intergenic
957459444 3:80497683-80497705 CAGCTGGGTGTGCATGCTCAGGG - Intergenic
958477068 3:94598241-94598263 CTGTAGAGTGTGCATGCCCAAGG - Intergenic
964346290 3:155757746-155757768 CCACAGAGCGTGCATGCCCAAGG - Intergenic
966465534 3:180227630-180227652 CAGATGAGGGAACTTGCCCAGGG + Intergenic
966466498 3:180235594-180235616 CAGATGAGGGAACTTGCCCAGGG + Intergenic
967212758 3:187183359-187183381 CAGATGAGGGAACCTGCCCAGGG + Intergenic
968380889 4:94967-94989 CAGATGAGGGAACCTGCCCAGGG + Intergenic
969187481 4:5487294-5487316 CAGATGACTGCTCATGCCCATGG - Intronic
969903546 4:10372022-10372044 CAGATGAGGGAACCTGCCCAGGG - Intergenic
971277217 4:25209820-25209842 CAGATGAGCCTGAATTCCAAAGG + Intronic
971796445 4:31234690-31234712 CAGATGAGGGAACCTGCCCAGGG - Intergenic
972346852 4:38199578-38199600 CAGATGAGGGTGCAGGTGCAAGG - Intergenic
973159637 4:46999891-46999913 GAGATAACTGTGCATGCCCAAGG + Intronic
974147626 4:57966958-57966980 CAGATGTAGGTGCATGGCCAAGG + Intergenic
979933516 4:126663051-126663073 CAGATGAGGGAACCTGCCCAGGG + Intergenic
985402018 4:189602030-189602052 TAGGTGAGCCTGCATGCTCAGGG - Intergenic
988157290 5:27472145-27472167 CAGATGAGGGAACCTGCCCAGGG + Intergenic
993624267 5:90205191-90205213 AAGGTGACCATGCATGCCCAGGG + Intergenic
995433302 5:112106511-112106533 GAGATAAGTGTGCATGCCCAAGG - Intergenic
998179740 5:139928184-139928206 CAAGTGAGCATGAATGCCCAGGG + Intronic
998215200 5:140232964-140232986 CAGATGACCATCCATGCCCTGGG + Intronic
999185888 5:149708428-149708450 CAGATGTGACTGGATGCCCATGG - Intergenic
1001044835 5:168363798-168363820 CAGGTTAGAGTTCATGCCCAAGG + Intronic
1001339162 5:170827686-170827708 CAGCTGAGCCTGAATCCCCAAGG - Intergenic
1008564594 6:52754812-52754834 GACCTCAGCGTGCATGCCCAAGG + Intronic
1012595437 6:101032693-101032715 CAGATGAGGGAACCTGCCCAGGG + Intergenic
1012777205 6:103512554-103512576 TAGATGGACGTGGATGCCCAAGG + Intergenic
1014953410 6:127586516-127586538 CAGATGAGGAAACATGCCCAGGG - Intronic
1020627416 7:10599409-10599431 CAGATGAGGGAACCTGCCCAGGG + Intergenic
1022377575 7:29828886-29828908 CAGATGAGCACCCCTGCCCAAGG + Intronic
1025615685 7:63114342-63114364 CAGATGGCCGCGCACGCCCAGGG + Intergenic
1031112652 7:117630728-117630750 CAGATGAGGGAACCTGCCCAAGG - Intronic
1032250870 7:130256269-130256291 CAGATGAGGGAACCTGCCCAGGG + Intergenic
1032251585 7:130262275-130262297 CAGATGAGGGAACCTGCCCAGGG + Intergenic
1033132626 7:138758076-138758098 AAGATGAGCGTGGACGCCGAAGG - Intronic
1040555839 8:48476896-48476918 CAGAGGAGGCTGCATGGCCAGGG - Intergenic
1041910677 8:63085798-63085820 CGGGTAAGCGTGCGTGCCCAGGG - Exonic
1046036431 8:108847648-108847670 GAGATGAGCGGGCAAGCCCCTGG - Intergenic
1046412103 8:113859181-113859203 CAGATGAGGGAACCTGCCCAGGG + Intergenic
1048420067 8:134269469-134269491 CAGAAGTGTGTGCAGGCCCAGGG + Intergenic
1049207547 8:141370515-141370537 GAGGTGAGCCTGCATGTCCAGGG + Intergenic
1054173503 9:61860003-61860025 CAGGTCAGCCTGCATGCCCCTGG - Intergenic
1054664039 9:67720778-67720800 CAGGTCAGCCTGCATGCCCCTGG + Intergenic
1056703646 9:88933008-88933030 CAGATGAGGGAACCTGCCCAGGG - Intergenic
1057329805 9:94103374-94103396 AAGCTGAGGTTGCATGCCCAAGG + Intronic
1059422587 9:114201462-114201484 CAGAAGAGCGAGCATAGCCAAGG - Intronic
1060602381 9:124886870-124886892 CAGAGGGGCGTGAAGGCCCACGG + Intronic
1061630422 9:131868739-131868761 CAGATAAAGGTGCAGGCCCAGGG + Intronic
1062428718 9:136517539-136517561 CAGATGAGGGTGCCGGGCCAGGG - Intronic
1062547430 9:137070017-137070039 CAGAGGGGCGCGCACGCCCAGGG + Exonic
1186538514 X:10374529-10374551 TACATGAGTGTGCCTGCCCAAGG + Intergenic
1198139274 X:133786539-133786561 CAGATGAGGGAACTTGCCCAGGG + Intronic
1198399686 X:136256816-136256838 CAGATGAGGAAGCAGGCCCAGGG + Intergenic
1199038630 X:143083586-143083608 CAGATGAGCATGGATACCAAAGG + Intergenic
1199066621 X:143426417-143426439 CAGATAACTGTGAATGCCCAAGG + Intergenic