ID: 1064443101

View in Genome Browser
Species Human (GRCh38)
Location 10:15371047-15371069
Sequence GCTCATCTCCGCCGCGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064443093_1064443101 22 Left 1064443093 10:15371002-15371024 CCAGACGTGGCAGCCCAGCAGGC 0: 1
1: 0
2: 3
3: 13
4: 206
Right 1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 106
1064443091_1064443101 26 Left 1064443091 10:15370998-15371020 CCTTCCAGACGTGGCAGCCCAGC 0: 1
1: 0
2: 4
3: 36
4: 319
Right 1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 106
1064443094_1064443101 9 Left 1064443094 10:15371015-15371037 CCCAGCAGGCACAGCAGCAGCGT 0: 1
1: 0
2: 0
3: 23
4: 234
Right 1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 106
1064443090_1064443101 29 Left 1064443090 10:15370995-15371017 CCGCCTTCCAGACGTGGCAGCCC 0: 1
1: 0
2: 3
3: 30
4: 268
Right 1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 106
1064443095_1064443101 8 Left 1064443095 10:15371016-15371038 CCAGCAGGCACAGCAGCAGCGTC 0: 1
1: 1
2: 1
3: 33
4: 348
Right 1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064443101 Original CRISPR GCTCATCTCCGCCGCGGGGC CGG Exonic
900113550 1:1019604-1019626 GCGCCCCTCCCCCGCGGGGCCGG - Intergenic
900648144 1:3718202-3718224 GCTCCTCCCCGGGGCGGGGCGGG + Intronic
901007582 1:6179485-6179507 GCCCATGTCGGCCGCGGGGCGGG - Intronic
903967256 1:27098615-27098637 GCCGCTCTCCCCCGCGGGGCAGG + Intergenic
905549268 1:38823140-38823162 GCTCAGCTCCTCCTCTGGGCTGG + Intergenic
909431310 1:75590544-75590566 GCTCCTCTCTGCCCCAGGGCAGG - Intronic
912408873 1:109466434-109466456 GGTTAGTTCCGCCGCGGGGCGGG - Intergenic
915147343 1:153802863-153802885 GCTCCTCTCCGGGGAGGGGCAGG + Intergenic
915161317 1:153922674-153922696 GCTCCTCACCGCCCCCGGGCGGG + Intronic
915246326 1:154558559-154558581 GCTCCGCTCCGCTCCGGGGCCGG + Exonic
916084530 1:161258958-161258980 GCTCATCTCCGCAGCCGGACAGG - Exonic
916588295 1:166166603-166166625 CCTCCTCTCCGGCGAGGGGCGGG - Exonic
917869637 1:179229743-179229765 AGTCACCTCCGCCGCGGGGAAGG + Intergenic
924801495 1:247331954-247331976 GCACACCTCGGCCGGGGGGCGGG - Intergenic
1064443101 10:15371047-15371069 GCTCATCTCCGCCGCGGGGCCGG + Exonic
1068120526 10:52779115-52779137 GCTCAGCTTTGCCGCGAGGCCGG - Intergenic
1076872135 10:133199352-133199374 GCTGATCTCGGCTGGGGGGCTGG - Intronic
1076909975 10:133382414-133382436 GCTCATCCCTGCCCCGGGGAGGG - Intronic
1079035076 11:17014023-17014045 CCTCCTCCCAGCCGCGGGGCAGG + Exonic
1083751866 11:64765493-64765515 GGCCATCGCCGCCGCGGGGAGGG + Exonic
1083908768 11:65692733-65692755 GCTCATCTCAGCCCCGGGCTTGG - Intergenic
1084516558 11:69640935-69640957 GGGCAACTCCGCCGCAGGGCAGG + Intergenic
1087252930 11:95923943-95923965 GCTCTTCTCCATCGCGCGGCAGG + Exonic
1088315003 11:108498390-108498412 CCTCCTCGCCGCCGCGGAGCTGG - Exonic
1089147843 11:116343326-116343348 GCCCATCACCGCCTTGGGGCAGG - Intergenic
1089214953 11:116829697-116829719 GCTCATCTGGGCTGCAGGGCTGG + Intronic
1089347054 11:117797249-117797271 GCTCCTGTCATCCGCGGGGCTGG + Exonic
1091765494 12:3117572-3117594 GCCCAGCTCTGCCCCGGGGCAGG + Intronic
1091857772 12:3753127-3753149 GTTCAGCTCCGCTGAGGGGCTGG - Intronic
1094719937 12:33052919-33052941 GCTCACCGCCGCCGCCGGGCAGG + Intergenic
1096117096 12:49060929-49060951 CCTCCTCTCCGCCGCGGCCCTGG + Intergenic
1102197229 12:111034257-111034279 GCTCCTCACGGCCGCGCGGCCGG - Intronic
1104819367 12:131665911-131665933 GCTCACCTGCGAAGCGGGGCGGG - Intergenic
1108478450 13:50843467-50843489 GCTCAGGCCCGCCGCGGGCCCGG - Exonic
1114126283 14:19730025-19730047 GGTCATCTCCCCCTCTGGGCAGG + Intronic
1119318433 14:73714439-73714461 GAGCAGCTCCGCCGCGGGGGCGG - Intergenic
1120976881 14:90256760-90256782 GCTCATGTCCACCGCGGGCCGGG + Intronic
1122624099 14:103075439-103075461 GCTCGGCTCCGGCGCGGAGCGGG - Intergenic
1126102820 15:45129925-45129947 GCTCGGCTCAGCCACGGGGCGGG - Exonic
1132232643 15:100195268-100195290 GCTCGTGTCCGCAGCAGGGCTGG + Intronic
1136398097 16:30003991-30004013 CCTCATCTCCGCTGCTGGGGTGG - Intronic
1136472300 16:30489232-30489254 GCTCATCTCCTTCCCTGGGCAGG + Exonic
1137368848 16:47886279-47886301 TCTCATCGCTGACGCGGGGCTGG - Intergenic
1138507681 16:57486336-57486358 GCTCAGCGGCGCCGCGGAGCAGG + Exonic
1141691961 16:85601556-85601578 GCTCACCTTCAGCGCGGGGCCGG + Intergenic
1141963250 16:87423639-87423661 GCTCATGTCAGCAGCGGGCCTGG + Intronic
1142206416 16:88785156-88785178 GCTGCGCTCCGCCGAGGGGCAGG - Exonic
1143107825 17:4538268-4538290 GCTCAGCTCAGCCTCGGGGAAGG - Exonic
1144851668 17:18247069-18247091 GCTCAGACCTGCCGCGGGGCGGG - Intronic
1146794293 17:35770268-35770290 GCGCTTCGCCGCGGCGGGGCAGG + Exonic
1148534804 17:48430237-48430259 GCCCAGCCCGGCCGCGGGGCGGG + Intronic
1148741729 17:49897081-49897103 GCTCATCTCCCCCTCAGGGCTGG + Intergenic
1151939019 17:77281352-77281374 GCGCATCTCCGGGGAGGGGCGGG + Intronic
1152134165 17:78494250-78494272 TATCATCTCCCCCACGGGGCAGG - Intronic
1155654027 18:28175820-28175842 GCCCACCCTCGCCGCGGGGCAGG - Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160768977 19:821941-821963 GCGCGTCTCCTCCGTGGGGCGGG + Exonic
1162975471 19:14205501-14205523 GCTCCTCTGGGGCGCGGGGCCGG + Intronic
1166081062 19:40444349-40444371 GCTCGGCTCCGGGGCGGGGCTGG - Exonic
1167095500 19:47373114-47373136 GCTCCTCTCAGCCCCGGGCCTGG - Intronic
925091274 2:1157807-1157829 GCTCATATCACCCGCGGGGCAGG - Intronic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
931668995 2:64630130-64630152 GCTTATCTCCGCCGGGTGTCTGG + Intergenic
932702793 2:74002667-74002689 TCCCCTCCCCGCCGCGGGGCTGG - Intronic
937997960 2:127709370-127709392 GCTCATGTCTCCCGGGGGGCTGG - Intronic
941905018 2:170712067-170712089 CCCCATCTCCGCCCCGAGGCAGG + Intergenic
944553264 2:200864714-200864736 GCGCGTCTCCGCCGCGGGGCGGG + Intronic
944563323 2:200963390-200963412 GCCAAGCTCCGACGCGGGGCTGG + Intronic
945699392 2:213151660-213151682 GCACATCTCCCCCGCCGGCCGGG + Intronic
947765305 2:232633850-232633872 GCTCAGCTCCGCGTCGGCGCTGG - Exonic
1168947959 20:1777228-1777250 GCTCATCCCAGCCTCTGGGCCGG + Intergenic
1168947968 20:1777267-1777289 GCTCATCCCAGCCTCTGGGCCGG + Intergenic
1168947977 20:1777306-1777328 GCTCATCCCAGCCTCTGGGCCGG + Intergenic
1170007738 20:11687121-11687143 GCGCAGCTCTGCGGCGGGGCAGG + Intergenic
1171947416 20:31390541-31390563 GCTCATCTCTGCCGTGCTGCAGG - Intronic
1172245601 20:33443410-33443432 GCTCAACGGCGCCGCGGAGCCGG - Exonic
1182094051 22:27614389-27614411 GCTGATTGCCGCCGCGCGGCGGG - Intergenic
1183730054 22:39613383-39613405 GCTCATCTCTGCCTGGGGGTGGG + Intronic
1184518056 22:44975252-44975274 GCTCATCCCAGGCGTGGGGCTGG - Intronic
1185222404 22:49635789-49635811 GCTTCTGTCCACCGCGGGGCTGG + Intronic
949663066 3:6303966-6303988 GCTCAGCCCTGCCGGGGGGCAGG - Intergenic
954028679 3:47803009-47803031 GCTCCGCTCCCCCGCGGGCCTGG - Exonic
954224050 3:49171563-49171585 GCACTGCTCCGGCGCGGGGCGGG - Intergenic
968510174 4:992091-992113 GCTCACCTCCCCAACGGGGCAGG + Intronic
968775449 4:2537019-2537041 GCGCAGCGCCGCCGCCGGGCCGG - Intronic
969813764 4:9670921-9670943 TCACAGCTCCGCCGTGGGGCTGG + Intergenic
975139145 4:70902520-70902542 GCTCATGTTGGCCGCGGGGCAGG - Exonic
981069882 4:140523960-140523982 GCGCTACTCCGGCGCGGGGCGGG + Intergenic
985783305 5:1881894-1881916 GCTCAACTCGGCCGCGGCGCTGG - Exonic
991198407 5:63961563-63961585 GCTCATCTTCTGCGCGGTGCTGG - Exonic
991690121 5:69217693-69217715 GCTCTCCTCCGCCGTGGGGCTGG - Intergenic
998157716 5:139795949-139795971 GCTGGTCCCCGCCGCGGGTCCGG - Exonic
1002057994 5:176609790-176609812 GCTCCTCGCCGGGGCGGGGCGGG - Intronic
1002699805 5:181114791-181114813 GCTCATCGCTGCCGTGGTGCTGG + Intergenic
1003948104 6:11093773-11093795 GCTCGCCTCCTCCGCGGCGCGGG - Intergenic
1007275458 6:40670092-40670114 GCTCCTCTCCACCACAGGGCTGG - Intergenic
1016713884 6:147203096-147203118 GCTCCTCCCCGGCGAGGGGCTGG + Intergenic
1019331920 7:464534-464556 GCTCAGCTCGGCAGCGTGGCTGG - Intergenic
1020573034 7:9890351-9890373 GCTCCTCTCTGCCCCAGGGCAGG - Intergenic
1023999524 7:45181467-45181489 GCTCATCTCAGCCCTGGGGATGG + Intronic
1024712161 7:52027778-52027800 TCTCATCACCTCCGTGGGGCGGG + Intergenic
1025024140 7:55502465-55502487 GCTCATCTGCGGCGCTGGCCCGG + Intronic
1032870200 7:135977095-135977117 GCACATCACTGCAGCGGGGCAGG + Exonic
1040471239 8:47737578-47737600 GCTCTTCTCCCGGGCGGGGCCGG + Exonic
1045326121 8:101119006-101119028 GCTCATCTCCCCAGGGAGGCTGG + Intergenic
1051621029 9:19049539-19049561 GCTCCGCTCCGCCGCGCAGCTGG - Exonic
1055530197 9:77176956-77176978 GCTCATCTCAGATGCAGGGCAGG + Intergenic
1057309515 9:93933350-93933372 GCTCAGCTCCGCCACAGGGCAGG - Intergenic
1057772921 9:97983695-97983717 GCTCTTCCCCGCGCCGGGGCCGG - Intronic
1058157732 9:101533861-101533883 CCTTGTCTCCGCCGCGGGTCAGG + Exonic
1058431724 9:104926691-104926713 TCGGAGCTCCGCCGCGGGGCTGG - Intronic
1059483634 9:114611309-114611331 GCTCCGCTCCGCCGCGGGCCCGG + Exonic
1059900588 9:118921204-118921226 GCTCATCTCTGGCCCAGGGCAGG + Intergenic
1060814327 9:126626784-126626806 ACAAATCACCGCCGCGGGGCTGG - Intronic
1060970035 9:127732576-127732598 GGTCATCTCCCGCGCGGTGCTGG - Exonic
1061498499 9:130989445-130989467 GCTCATCCCAGCCGGGGGACAGG - Intergenic
1062025408 9:134338039-134338061 GCCCATCTCCCCCGCTGGCCTGG - Intronic
1196824276 X:119728662-119728684 TCTCATCTCCGCCAGGTGGCAGG + Intergenic