ID: 1064456651

View in Genome Browser
Species Human (GRCh38)
Location 10:15493274-15493296
Sequence TTTGAGTTCTTCAAGAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064456651_1064456653 2 Left 1064456651 10:15493274-15493296 CCAAGACTCTTGAAGAACTCAAA No data
Right 1064456653 10:15493299-15493321 TTCTTTTTGGTTATGTACTTAGG No data
1064456651_1064456655 12 Left 1064456651 10:15493274-15493296 CCAAGACTCTTGAAGAACTCAAA No data
Right 1064456655 10:15493309-15493331 TTATGTACTTAGGGTTTAATTGG No data
1064456651_1064456654 3 Left 1064456651 10:15493274-15493296 CCAAGACTCTTGAAGAACTCAAA No data
Right 1064456654 10:15493300-15493322 TCTTTTTGGTTATGTACTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064456651 Original CRISPR TTTGAGTTCTTCAAGAGTCT TGG (reversed) Intergenic
No off target data available for this crispr