ID: 1064458778

View in Genome Browser
Species Human (GRCh38)
Location 10:15513118-15513140
Sequence CTCAGTATGTTTCGTATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064458778_1064458781 7 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458781 10:15513148-15513170 TGTGGTTTCTGCTCTCATTGAGG No data
1064458778_1064458782 8 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458782 10:15513149-15513171 GTGGTTTCTGCTCTCATTGAGGG No data
1064458778_1064458786 28 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458786 10:15513169-15513191 GGGGTCACTCAGCCGGAAGGTGG No data
1064458778_1064458783 9 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458783 10:15513150-15513172 TGGTTTCTGCTCTCATTGAGGGG No data
1064458778_1064458784 21 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458784 10:15513162-15513184 TCATTGAGGGGTCACTCAGCCGG No data
1064458778_1064458785 25 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458785 10:15513166-15513188 TGAGGGGTCACTCAGCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064458778 Original CRISPR CTCAGTATGTTTCGTATACC TGG (reversed) Intergenic
No off target data available for this crispr