ID: 1064458781

View in Genome Browser
Species Human (GRCh38)
Location 10:15513148-15513170
Sequence TGTGGTTTCTGCTCTCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064458778_1064458781 7 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458781 10:15513148-15513170 TGTGGTTTCTGCTCTCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064458781 Original CRISPR TGTGGTTTCTGCTCTCATTG AGG Intergenic
No off target data available for this crispr