ID: 1064458784

View in Genome Browser
Species Human (GRCh38)
Location 10:15513162-15513184
Sequence TCATTGAGGGGTCACTCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064458778_1064458784 21 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458784 10:15513162-15513184 TCATTGAGGGGTCACTCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064458784 Original CRISPR TCATTGAGGGGTCACTCAGC CGG Intergenic
No off target data available for this crispr