ID: 1064458786

View in Genome Browser
Species Human (GRCh38)
Location 10:15513169-15513191
Sequence GGGGTCACTCAGCCGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064458778_1064458786 28 Left 1064458778 10:15513118-15513140 CCAGGTATACGAAACATACTGAG No data
Right 1064458786 10:15513169-15513191 GGGGTCACTCAGCCGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064458786 Original CRISPR GGGGTCACTCAGCCGGAAGG TGG Intergenic
No off target data available for this crispr