ID: 1064465923

View in Genome Browser
Species Human (GRCh38)
Location 10:15581882-15581904
Sequence AGGTGCCAAAGTAATTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064465919_1064465923 18 Left 1064465919 10:15581841-15581863 CCAGAAATAGACTCTCACATATA No data
Right 1064465923 10:15581882-15581904 AGGTGCCAAAGTAATTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064465923 Original CRISPR AGGTGCCAAAGTAATTCAGT GGG Intronic
No off target data available for this crispr