ID: 1064466823

View in Genome Browser
Species Human (GRCh38)
Location 10:15591739-15591761
Sequence GGTGAGATACTCCATTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064466823_1064466826 2 Left 1064466823 10:15591739-15591761 CCCTCAAAATGGAGTATCTCACC 0: 1
1: 0
2: 1
3: 18
4: 230
Right 1064466826 10:15591764-15591786 CATCCTGCCACAGTGCGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064466823 Original CRISPR GGTGAGATACTCCATTTTGA GGG (reversed) Intronic
900926812 1:5711181-5711203 GGAGAGCTCCTCCACTTTGAGGG + Intergenic
901416872 1:9122316-9122338 TGTGAGATACTCAATGTTCAGGG - Intronic
903689454 1:25161507-25161529 GGAGAGATAGTCCATGTTCATGG + Intergenic
905409732 1:37760417-37760439 GGGGAGATCCTTCATGTTGAGGG - Intronic
906717476 1:47980810-47980832 AGTGAGATAGTCCATTTTCTAGG - Intronic
908819502 1:68069366-68069388 GGAGAGATATTCCATGTTCATGG - Intergenic
908992077 1:70103380-70103402 GGAAAGATTCTCCATTTTTAAGG - Intronic
909026909 1:70492617-70492639 GGAAAGATACTCCATGTTCATGG + Intergenic
912781181 1:112549429-112549451 GGAGAGACATTCCATGTTGATGG - Intronic
912992632 1:114504422-114504444 GGTGAGTGACTCCATTTGGGAGG - Intronic
916865657 1:168854663-168854685 GGTGAAATAGTCCATGTTTATGG + Intergenic
917911929 1:179657240-179657262 GGGGAGATACACCATGTTCATGG - Intronic
918643053 1:186867327-186867349 GGAGAGATATTCCATATTCATGG - Intronic
919440177 1:197623944-197623966 GGAGAGATATTCCATGTTCATGG + Intronic
921882221 1:220268458-220268480 GGTAAGATACTCTTTTGTGATGG - Intronic
922033525 1:221826473-221826495 AGAGTGAAACTCCATTTTGAAGG + Intergenic
922181448 1:223236976-223236998 GGAGAGATAGTCCATATTCATGG - Intronic
922319797 1:224476667-224476689 GGTAAGATAGTCCATGTTCATGG + Intronic
923065781 1:230515996-230516018 AGTGAGATCCTGCATTTTGCAGG - Intergenic
923619073 1:235562780-235562802 GGAGAGATAGTCCATGTTCATGG - Intronic
923798316 1:237181911-237181933 GGTGAGTCACTGCTTTTTGATGG - Intronic
1062778099 10:172613-172635 GATGAGATATTCCATGTTCATGG + Intronic
1063004608 10:1956817-1956839 GGAGAGATACTCTATTTTCATGG - Intergenic
1064043040 10:11985160-11985182 AGTTAGATACTCCATTTTCTCGG + Intronic
1064466823 10:15591739-15591761 GGTGAGATACTCCATTTTGAGGG - Intronic
1065619227 10:27562338-27562360 GGAGAGATATTCCATGTTCATGG - Intergenic
1065954443 10:30680782-30680804 GGAGAGATATTCCATGTTCATGG - Intergenic
1066498638 10:35968553-35968575 AGAGAGATATTCCATTTTCATGG + Intergenic
1067578050 10:47420151-47420173 GGTGAGAAGCCTCATTTTGAGGG - Intergenic
1067956073 10:50792767-50792789 GGAGAGATACACCATGTTCATGG - Intronic
1070266014 10:74903957-74903979 ACTGAGATACTCCATGTGGATGG + Intronic
1072369492 10:94750163-94750185 GGAAAGATATTCCATGTTGATGG - Intronic
1072385288 10:94919290-94919312 GGAAAGATATTCCATGTTGATGG - Intergenic
1074486330 10:113886252-113886274 GGAGAGATATTCCATGTTCATGG + Intronic
1075515010 10:123101525-123101547 AATAAGATACTCCATTTTGGTGG - Intergenic
1078554388 11:12308390-12308412 TGAGAGATACACCATTTTCATGG - Intronic
1080459569 11:32441396-32441418 GGTGAGCTATTCCATTTTTCTGG - Intergenic
1081246137 11:40769344-40769366 GGTAAGATACTCCACATTCATGG + Intronic
1081280074 11:41198678-41198700 GGAAAGACACTCCATTTTCACGG + Intronic
1084454311 11:69258742-69258764 CGAGAGATAGTCCATGTTGATGG + Intergenic
1084989778 11:72911611-72911633 GGAAAGATATTCCATGTTGATGG - Intronic
1086114060 11:83228827-83228849 AGTGAGATACTCCAAATCGAGGG - Intronic
1087186289 11:95200630-95200652 GATGAGATTCCCCATTATGAAGG - Intronic
1087645901 11:100808042-100808064 GGTGAGGCACTCAATTTTAAAGG + Intronic
1087825295 11:102758020-102758042 AGTGTGATACTCCATTTAGATGG - Intergenic
1090168230 11:124574932-124574954 GGAGAGATATTCCATATTCATGG + Intergenic
1090317895 11:125812455-125812477 GGTAAGATATTCCATTTTGATGG - Intergenic
1090465987 11:126933831-126933853 GGAGAGACATTCCATTTTAATGG + Intronic
1090681911 11:129068849-129068871 GATGAGATACTGCAAATTGAGGG - Intronic
1090898362 11:131001574-131001596 GAAGAGATCCTCCATTTTTAAGG - Intergenic
1091488100 12:908945-908967 GGGGAGACTCTCCATTCTGAGGG - Exonic
1092121718 12:6049040-6049062 GAAGAAATACTCCATTGTGATGG + Intronic
1097778686 12:63678071-63678093 GGAGAGATAGTCCATGTTCATGG - Intergenic
1098060767 12:66559687-66559709 GGAAAGATACTCCATGTTCATGG + Intronic
1098404116 12:70106040-70106062 GGTGAAATACTCAAATTTGGTGG - Intergenic
1099041666 12:77662179-77662201 GGTGAGATATGCCATTTTCATGG - Intergenic
1101018686 12:100529577-100529599 GGGTAGATACTCCATCTTGGTGG - Intronic
1101229020 12:102720838-102720860 GCTGAGATGCACCATTTTAATGG - Intergenic
1101811437 12:108111510-108111532 GGTCATAGACTCCATTTTCAGGG + Intergenic
1102203171 12:111072240-111072262 GGGGAGATAGTCCATGTTCATGG - Intronic
1104711007 12:130986275-130986297 GGAGAGATATTCCATATTCATGG - Intronic
1104723910 12:131063911-131063933 GGAGAGATACGCCATGTTAATGG - Intronic
1104867692 12:131968696-131968718 GGAGAGATACACCATATTCATGG - Intronic
1105295095 13:19081959-19081981 GGAGAGATATTCCATGTTCATGG + Intergenic
1105558315 13:21466335-21466357 GGTGAGGTACCCCGTTTTTAAGG - Intergenic
1105770288 13:23604371-23604393 GGAGAGATATTCCATGTTTATGG + Intronic
1106543923 13:30714469-30714491 GGGCAGATGCTCCATTTTGGGGG + Intronic
1109634099 13:65090716-65090738 GGTGAGATGGTCTATTGTGAAGG + Intergenic
1110761452 13:79235167-79235189 GGTCTGTTACTTCATTTTGACGG - Intergenic
1111689724 13:91548474-91548496 GGAGAGATACTCCATGTTCATGG + Intronic
1112323239 13:98426186-98426208 GCTGAGATACATCATTTTAATGG - Intronic
1112681297 13:101768334-101768356 GAAGAGATACTCCATCTTCATGG + Intronic
1113435492 13:110287886-110287908 GATGAGATACTCCCTATTGGTGG - Intronic
1115381164 14:32740989-32741011 GGAAAGACACTCCATTTTCATGG - Intronic
1117258111 14:54000876-54000898 CATGAGATACACCATTTTGATGG + Intergenic
1117633578 14:57719446-57719468 GGAGAGATATTCCATGTTCATGG - Intronic
1117794235 14:59375255-59375277 GGTGAGATAGTTCATATTCATGG + Intergenic
1120272745 14:82335301-82335323 GGAGAGATACTCCATGTTCATGG + Intergenic
1121094956 14:91211197-91211219 GGAGAGATATTCCATGTTCATGG + Intronic
1122360454 14:101157872-101157894 GGAGAGATATTCCATGTTCATGG - Intergenic
1122376029 14:101258032-101258054 GGAGAGATAGACCATTTTTATGG - Intergenic
1123765602 15:23475208-23475230 AGTTAGATACTCTATTTTGATGG + Intergenic
1126328345 15:47505935-47505957 GCAGAGATACTCCAGTCTGAAGG + Intronic
1126642211 15:50839728-50839750 GGTGGGATATTCCATGTTCATGG - Intergenic
1126824906 15:52539367-52539389 GGTGTGTTACTCCATTCTCATGG + Intergenic
1130305856 15:82711675-82711697 GGAGAGATCATCCACTTTGAGGG - Intergenic
1131486208 15:92822894-92822916 GGTTAAATCCTCTATTTTGATGG + Intergenic
1132401268 15:101506959-101506981 GGTGTGAGCCTCCATTCTGATGG - Intronic
1134465677 16:14475052-14475074 GGAGAGCTACTCAATTTTCAAGG + Intronic
1135747584 16:25030323-25030345 GCTGAAATACACCATTTTGTTGG - Intergenic
1136002796 16:27308001-27308023 GGAGAGATAGTCCATGTTCATGG + Intergenic
1139939403 16:70594243-70594265 GGAGAGATATTCCATGTTCATGG - Intronic
1143164698 17:4892049-4892071 GGTGAGCTCCCCCACTTTGATGG - Intronic
1143233737 17:5379974-5379996 GGAGAGATACTCCAATAAGAGGG - Intronic
1148454319 17:47802739-47802761 GGACAGATGCTTCATTTTGAGGG + Intergenic
1150479584 17:65499152-65499174 GGTGAGATACTGCCTTTGGAGGG - Intergenic
1151121863 17:71801584-71801606 GGTGAGTCACTCCCTTTTCAAGG - Intergenic
1153431379 18:5021286-5021308 GGTGAAAACCTCCACTTTGAGGG + Intergenic
1155665336 18:28300782-28300804 GGTGAGATATTCCATGTTCATGG + Intergenic
1156061920 18:33088410-33088432 GGAGAGATATTCCATATTCATGG - Intronic
1157765009 18:50289588-50289610 CGTGAGTGACTCCATTTTGGTGG - Intergenic
1158028874 18:52937977-52937999 GGTGAAATAGTCCATGTTCAAGG + Intronic
1158173581 18:54627253-54627275 GGAAAGATACTCCATGTTCATGG + Intergenic
1159648475 18:70948535-70948557 GGAAAGATATTCCATTTTCATGG + Intergenic
1159848568 18:73497252-73497274 GTTAAGTTACCCCATTTTGATGG + Intergenic
1164359030 19:27480096-27480118 TCTGAGAAACTGCATTTTGATGG + Intergenic
1164665599 19:30032383-30032405 GGAGAGGTACTCCATGTTCATGG - Intergenic
1165608658 19:37131272-37131294 GGAAAGATACTTTATTTTGAGGG + Intronic
1166515295 19:43442241-43442263 GGGGAGATGCTGCATTTTGGAGG - Intergenic
925524595 2:4786121-4786143 GGTGACATTTTCCATTTTCAAGG + Intergenic
925784207 2:7413401-7413423 GGAGAGATATTCCATGTTCATGG - Intergenic
928182288 2:29077309-29077331 GGTGAAACATTCCATTTTTATGG + Intergenic
931314356 2:61113452-61113474 GGAGAGATATTCCATGTTCATGG - Intronic
932138890 2:69257462-69257484 GGAGAGATATTCCATGTTTATGG + Intergenic
933136869 2:78747902-78747924 GGAGAGATACACCATGTTCATGG - Intergenic
936749596 2:115625477-115625499 GTGGAGCTACTCCATTCTGAGGG + Intronic
936777439 2:115991073-115991095 GGGGAGATAGTCCCTTTTTATGG - Intergenic
940313129 2:152300028-152300050 AGAGAGATATTCCATTTTCATGG - Intergenic
941265911 2:163362021-163362043 GGAGAGATATTCCATTTTCATGG - Intergenic
941408614 2:165124525-165124547 GATGAGCTCCTCCATTTTCAGGG + Intronic
943464690 2:188214688-188214710 GGAGAGATATTCCATGTTTATGG - Intergenic
947039606 2:225901778-225901800 GGAAAGATACTCCATGTTCATGG + Intergenic
948775060 2:240282552-240282574 GGAGAGATATTCCATGTTAATGG + Intergenic
1169032936 20:2426129-2426151 GGAGAGATATTCCATGTTCATGG - Intronic
1169069739 20:2717080-2717102 GGTGAGATAAACCATATTCATGG - Intronic
1169180591 20:3562828-3562850 TGTGCAATACTCCATTTTGTGGG + Intronic
1169312564 20:4558167-4558189 GGAGAGATATTCCATGTTCATGG + Intergenic
1169318957 20:4615482-4615504 GGTCAGATACTCCCTTCTGTTGG - Intergenic
1169643890 20:7787470-7787492 GAAGAGATACTACATTTTCATGG + Intergenic
1170722334 20:18894145-18894167 GGAGAGATATGCCATGTTGATGG + Intergenic
1171106856 20:22441808-22441830 GGAGGAACACTCCATTTTGAGGG + Intergenic
1171415334 20:24975537-24975559 GGAGAGATATTCCATGTTCATGG + Intronic
1172265457 20:33608852-33608874 GGAAAGTTGCTCCATTTTGAAGG - Intronic
1173599824 20:44286101-44286123 GGAAAGATACTCCATGTTCATGG - Intergenic
1173952280 20:47002781-47002803 GGAGAGCTAGTCCATATTGATGG + Intronic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1174745467 20:53057817-53057839 TGTGAGAAAGTCCATTGTGAAGG + Intronic
1177024139 21:15901002-15901024 GGAAAGATACTTCATGTTGATGG + Intergenic
1177387365 21:20425503-20425525 GGTGAGGTCCTGCAATTTGAGGG + Intergenic
1178421154 21:32444396-32444418 TGTGAGCCACTCCATATTGATGG - Intronic
1179939986 21:44631395-44631417 AGTGAAATACTCCAGTCTGAAGG + Intronic
1181156038 22:20921665-20921687 GGTGAGAAAGTCCATTGTGTTGG + Intronic
1184494111 22:44827311-44827333 GGTGAGATAATACATTTGGGTGG + Intronic
1185160296 22:49222526-49222548 GGAGAAATACTCCATGTTCATGG + Intergenic
949143766 3:669930-669952 GGAGAGATATACCATGTTGATGG + Intergenic
950827491 3:15840402-15840424 GGAAAGATACTCCATGTTCATGG + Intronic
950959111 3:17085927-17085949 GGAGAGATATTCCATATTCATGG + Intronic
951355050 3:21656105-21656127 GGTGAGAGACTCTATATTGTGGG - Intronic
952361441 3:32634012-32634034 GGAGAGATATTCCATGTTCATGG - Intergenic
953297207 3:41731494-41731516 GGAAAGATACTCCATGTTCATGG + Intronic
953600104 3:44354536-44354558 GGAGAGATACTCCATGTTCATGG - Intronic
954455874 3:50599570-50599592 GGGGAGGTTCTCCATTCTGAAGG + Intergenic
956074957 3:65495301-65495323 AATGAGATAATCCTTTTTGAGGG + Intronic
957645816 3:82924378-82924400 GAAGAGATAGTCCATGTTGATGG + Intergenic
958443728 3:94189144-94189166 GGGGAGATATTCCATGTTTATGG - Intergenic
959341990 3:105143490-105143512 GGTGACAAACTTCCTTTTGAAGG + Intergenic
959639575 3:108617685-108617707 GGTGAGTTACACCATTCAGAAGG + Intronic
960092558 3:113656299-113656321 GGTAAGATAATCTCTTTTGACGG + Exonic
963330293 3:143906653-143906675 GGAGAGATACTCCATGTTCATGG - Intergenic
964264899 3:154884083-154884105 GGAGAGATATTCCATATTCATGG + Intergenic
965114694 3:164473547-164473569 GGAGAGATATTCCATTTTTATGG - Intergenic
965308123 3:167093730-167093752 GGTGAAACACTCAATTTTAAAGG + Intergenic
965664820 3:171082058-171082080 GGTGAGAGACTTCTTTTTGGAGG + Intronic
965924668 3:173963101-173963123 GATGAGATAATGCATTTTAAAGG - Intronic
966464876 3:180219527-180219549 GGAGAGATATTCCATATTTATGG + Intergenic
971821591 4:31563713-31563735 GGAGAGATATTCCATGTTCATGG + Intergenic
973249501 4:48046746-48046768 GCTAAAATACTCAATTTTGAGGG - Intergenic
974631883 4:64502063-64502085 GATGAGATACTCCATGTTGGGGG - Intergenic
975708128 4:77131090-77131112 GGAAAGATATTCCATTTTCATGG - Intergenic
976580794 4:86734135-86734157 TCTGAGACACTCCATTTAGATGG - Intronic
978172854 4:105694716-105694738 GATAATATACTCCATCTTGAGGG + Intronic
979890861 4:126092277-126092299 GGAGAGATATTCCATGTTCATGG - Intergenic
980019788 4:127695108-127695130 GGAGAGATATTCCATGTTCATGG - Intronic
984104143 4:175523304-175523326 GGAAAGATACTCCATGTTCATGG + Intergenic
986814031 5:11388528-11388550 GGTGCTATACTCCATTTCAATGG + Intronic
987576080 5:19730640-19730662 GCTGAGATACTGCTTTCTGATGG - Intronic
989148632 5:38274544-38274566 GATGATATACTCAGTTTTGAAGG + Intronic
989460454 5:41691994-41692016 GGGGAGATACTGGATTATGAGGG + Intergenic
993303509 5:86244689-86244711 GATCATATACTCTATTTTGATGG + Intergenic
994159787 5:96544186-96544208 GGAGAGATAGTCCATGTTCATGG - Intronic
994526272 5:100908746-100908768 GGAGAGATAGTCCATATTCATGG - Intergenic
994690511 5:103013193-103013215 GGGAAGATACTCCATGTTCATGG - Intronic
999092830 5:148952517-148952539 GGTGAGACACTCAACTTTGGAGG - Intronic
999799153 5:155017281-155017303 GGTAGGATCCTCCAGTTTGAAGG - Exonic
1000639014 5:163678861-163678883 GTTGAGCTACTCCATCTGGATGG + Intergenic
1001870050 5:175145892-175145914 GGGGAGATATTCCATATTCATGG + Intergenic
1002397341 5:178968317-178968339 GGTGAGGTGCTCCATTCTGAGGG - Intergenic
1002610002 5:180411045-180411067 GGAGAGATAGTCCATGTTCATGG + Intergenic
1004935521 6:20504045-20504067 GGAGAGATAGTCCATGTTCATGG + Intergenic
1005380385 6:25228185-25228207 GGTGGCAGACTCCATTTTGGGGG + Intergenic
1005720719 6:28599176-28599198 GGAGAGATATTCCATGTTCATGG + Intronic
1007931599 6:45696840-45696862 GCTGATACACACCATTTTGATGG + Intergenic
1008740934 6:54607220-54607242 GGAGAGATAGTCCATGTTCATGG - Intergenic
1011620583 6:89238713-89238735 GGAGAGATATTCCATTTTCATGG - Intergenic
1011778463 6:90759527-90759549 TGTGAGTTACTCCTTTTAGATGG - Intergenic
1012385081 6:98671530-98671552 GGTGGAATACTCCAAGTTGAAGG - Intergenic
1012702039 6:102470914-102470936 GAAGAGATATTCCATTTTCATGG - Intergenic
1013683804 6:112555098-112555120 GGAGAGATATTCCATGTTCATGG - Intergenic
1014235733 6:118952335-118952357 GGAAAGATACTCCATTTTCATGG - Intergenic
1014332068 6:120081236-120081258 GGAGAGATATTCCATGTTCATGG - Intergenic
1014348201 6:120302497-120302519 GGAGAGATATGCCATATTGATGG - Intergenic
1014544537 6:122717931-122717953 GGAGAGAGCCTCCAGTTTGAGGG - Exonic
1014591194 6:123273398-123273420 TGTTAAATACTCCATTTTGCAGG - Intronic
1015766729 6:136726311-136726333 GGTGAGATATTCTATATTCATGG - Intronic
1016538001 6:145130239-145130261 GGAGAGATATTCCATGTTTATGG - Intergenic
1019806849 7:3133547-3133569 GGAGAGATATTCCATGTTAATGG - Intergenic
1019940775 7:4287962-4287984 GGAGAGATAGTCCATGTTCATGG - Intergenic
1023103186 7:36739581-36739603 GGTGAGTTGCTCCAGGTTGATGG + Intergenic
1023962700 7:44940345-44940367 GGAGAGATACCCCATGTTCATGG + Intergenic
1024032439 7:45474324-45474346 GGAGAGATATTCCATGTTCATGG + Intergenic
1024221323 7:47289757-47289779 GGAGAGATATTCCATATTCATGG + Intronic
1024440536 7:49411530-49411552 GGTGAGATATTTCATGTTCATGG + Intergenic
1024846287 7:53646637-53646659 GGAGAGATATTCCATGTTCATGG - Intergenic
1025203349 7:56976108-56976130 GGAGAGATATTCCATGTTCATGG - Intergenic
1025668595 7:63600819-63600841 GGAGAGATATTCCATGTTCATGG + Intergenic
1028372512 7:90109859-90109881 GGAGAGATAGTCCATGTTCATGG + Intergenic
1030180162 7:106698917-106698939 GGAGAGATATTCCATATTCATGG - Intergenic
1030826481 7:114165635-114165657 GGAGAGATAGTCCCTTTTCATGG + Intronic
1030875444 7:114807749-114807771 GGTAAGATACTTCATTTCTAGGG + Intergenic
1031879832 7:127184983-127185005 GGAGGGATATTCCATTTTCAAGG + Intronic
1031958784 7:127969770-127969792 AGTGATATATTCCTTTTTGAGGG + Intronic
1035450707 7:158975341-158975363 GGAGAGATATTCCATATTCATGG + Intergenic
1036422281 8:8608837-8608859 GGAAAGATACTCCATGTTCATGG - Intergenic
1036718113 8:11145717-11145739 GGAGAGATACGCCATATTCATGG + Intronic
1038463862 8:27741968-27741990 ATTGCGATACTCCAATTTGAGGG + Intronic
1038474007 8:27849684-27849706 GGAGAGATATTCCATGTTCATGG - Intergenic
1038756375 8:30345000-30345022 GGAGAGATATTCCATGTTCATGG - Intergenic
1041305695 8:56456173-56456195 GGAGAGATATTCCGTATTGATGG + Intergenic
1041588592 8:59549675-59549697 GGTGAGATACTCACATTTGAAGG - Intergenic
1042165982 8:65946759-65946781 GGTCAGTTAGTTCATTTTGAGGG - Intergenic
1042275119 8:66996638-66996660 GGTGGAATACTCAATTTTTATGG + Intronic
1043312299 8:78876000-78876022 GGTGAGAGACTCCACTTAGTTGG - Intergenic
1046737124 8:117789179-117789201 GCTGAGAGAGTCTATTTTGAAGG - Intergenic
1048079820 8:131113762-131113784 GGAAAGATAATCCATTTTAATGG - Intergenic
1050316468 9:4406813-4406835 GGAAAGATACTCCATGTTCATGG + Intergenic
1050864832 9:10485486-10485508 GGAAAGATACTCCATGTTCATGG - Intronic
1053403309 9:37848007-37848029 GGGGAGATAGTCCATGTTCATGG + Intronic
1053586822 9:39467184-39467206 GGAGAGATATTCCATGTTAATGG - Intergenic
1054579486 9:66898046-66898068 GGAGAGATATTCCATGTTAATGG + Intronic
1056003775 9:82245077-82245099 GGAAAGATATTCCATGTTGATGG - Intergenic
1057264735 9:93607664-93607686 GGAGAGATATTCCATGTTCATGG - Intronic
1060274205 9:122169997-122170019 GCTGATTGACTCCATTTTGAAGG - Intronic
1060349607 9:122847451-122847473 AGTGAGATCTTCCATGTTGAAGG - Exonic
1060701369 9:125752102-125752124 GTTAAAATACTCCATGTTGATGG + Intronic
1191081523 X:56515746-56515768 GGAAAGATACTCCATGTTCATGG + Intergenic
1192357725 X:70419704-70419726 GGTAGGATCCTCCAGTTTGAAGG - Exonic
1192812980 X:74564323-74564345 GGGAAGATATTCCATGTTGATGG + Intergenic
1197582413 X:128299760-128299782 CTTGATATACTCCATTTTTAAGG - Intergenic
1198136717 X:133759137-133759159 GAAGAGATACTCCATGTTTATGG + Intronic
1201710034 Y:16980825-16980847 AGTCAGAGACTCCATCTTGAGGG + Intergenic