ID: 1064471761

View in Genome Browser
Species Human (GRCh38)
Location 10:15642491-15642513
Sequence TTAATCACCCTGACATTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064471759_1064471761 -6 Left 1064471759 10:15642474-15642496 CCAGGAGTTGAATTTCATTAATC 0: 1
1: 0
2: 0
3: 8
4: 183
Right 1064471761 10:15642491-15642513 TTAATCACCCTGACATTTTTGGG No data
1064471757_1064471761 7 Left 1064471757 10:15642461-15642483 CCTAAAATGCAACCCAGGAGTTG No data
Right 1064471761 10:15642491-15642513 TTAATCACCCTGACATTTTTGGG No data
1064471758_1064471761 -5 Left 1064471758 10:15642473-15642495 CCCAGGAGTTGAATTTCATTAAT 0: 1
1: 0
2: 1
3: 13
4: 245
Right 1064471761 10:15642491-15642513 TTAATCACCCTGACATTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064471761 Original CRISPR TTAATCACCCTGACATTTTT GGG Intronic
No off target data available for this crispr