ID: 1064475560

View in Genome Browser
Species Human (GRCh38)
Location 10:15684630-15684652
Sequence CCTCAAGTGCTGGAAATATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064475555_1064475560 -7 Left 1064475555 10:15684614-15684636 CCTCTTGTCTCAGCCTCCTCAAG 0: 1
1: 8
2: 322
3: 5181
4: 43037
Right 1064475560 10:15684630-15684652 CCTCAAGTGCTGGAAATATAGGG No data
1064475554_1064475560 9 Left 1064475554 10:15684598-15684620 CCTGGGCTTAAGTGATCCTCTTG 0: 38
1: 1072
2: 9739
3: 32443
4: 112697
Right 1064475560 10:15684630-15684652 CCTCAAGTGCTGGAAATATAGGG No data
1064475552_1064475560 26 Left 1064475552 10:15684581-15684603 CCAACTGGTCTCAATCTCCTGGG 0: 1
1: 15
2: 183
3: 614
4: 1766
Right 1064475560 10:15684630-15684652 CCTCAAGTGCTGGAAATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064475560 Original CRISPR CCTCAAGTGCTGGAAATATA GGG Intronic
No off target data available for this crispr