ID: 1064475560 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:15684630-15684652 |
| Sequence | CCTCAAGTGCTGGAAATATA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1064475555_1064475560 | -7 | Left | 1064475555 | 10:15684614-15684636 | CCTCTTGTCTCAGCCTCCTCAAG | 0: 1 1: 8 2: 322 3: 5181 4: 43037 |
||
| Right | 1064475560 | 10:15684630-15684652 | CCTCAAGTGCTGGAAATATAGGG | No data | ||||
| 1064475554_1064475560 | 9 | Left | 1064475554 | 10:15684598-15684620 | CCTGGGCTTAAGTGATCCTCTTG | 0: 38 1: 1072 2: 9739 3: 32443 4: 112697 |
||
| Right | 1064475560 | 10:15684630-15684652 | CCTCAAGTGCTGGAAATATAGGG | No data | ||||
| 1064475552_1064475560 | 26 | Left | 1064475552 | 10:15684581-15684603 | CCAACTGGTCTCAATCTCCTGGG | 0: 1 1: 15 2: 183 3: 614 4: 1766 |
||
| Right | 1064475560 | 10:15684630-15684652 | CCTCAAGTGCTGGAAATATAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1064475560 | Original CRISPR | CCTCAAGTGCTGGAAATATA GGG | Intronic | ||
| No off target data available for this crispr | |||||