ID: 1064485060

View in Genome Browser
Species Human (GRCh38)
Location 10:15778404-15778426
Sequence ATTTATTCACAGATGTATAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064485060 Original CRISPR ATTTATTCACAGATGTATAG GGG (reversed) Exonic
901377821 1:8852284-8852306 ATTTATACACAAATGTTCAGAGG + Intergenic
908996022 1:70155484-70155506 ATTTGTTCTGAGAGGTATAGAGG - Intronic
912095392 1:106134972-106134994 ATATAATCACAGATATATATTGG - Intergenic
913977102 1:143468784-143468806 ATTTATTCACAATTATACAGTGG + Intergenic
914071505 1:144294411-144294433 ATTTATTCACAATTATACAGTGG + Intergenic
914107650 1:144671945-144671967 ATTTATTCACAATTATACAGTGG - Intergenic
916262043 1:162851724-162851746 ATTCATTCAGAGATGTACTGGGG - Intronic
916672230 1:167032450-167032472 TTTTATTGATAGATGAATAGTGG - Intergenic
919322480 1:196060613-196060635 ATTTTTACTCAGATGTATTGTGG - Intergenic
920460208 1:206133893-206133915 ATTTGTATACAGATGTATAGGGG - Intergenic
921554972 1:216587052-216587074 ATTTTATCACAGATATATATAGG - Intronic
921878957 1:220231825-220231847 TTTCATTCACAGATGTAGTGTGG - Intronic
923443852 1:234049227-234049249 AATTATTTACATATGTATTGGGG - Intronic
923921641 1:238571816-238571838 ATTTATCCATTGATGTATAGTGG + Intergenic
1064485060 10:15778404-15778426 ATTTATTCACAGATGTATAGGGG - Exonic
1064927608 10:20586601-20586623 AATTATTCACATATCTATAAAGG - Intergenic
1065823319 10:29546621-29546643 ATATATACACAGATGTGTACAGG + Intronic
1067993390 10:51241400-51241422 ATTTATTCACATATTTGAAGAGG + Intronic
1068061603 10:52074670-52074692 ATTTATTAACAATTGTATAAAGG - Intronic
1068110041 10:52669646-52669668 ATTTAGCCACAGATTCATAGTGG + Intergenic
1068177065 10:53474741-53474763 ATTAAATCACAGAATTATAGTGG + Intergenic
1068219209 10:54021939-54021961 ATTAATTGACAGATGAATGGTGG + Intronic
1068235015 10:54222116-54222138 ATTCATTCAGAGAGGTATACAGG - Intronic
1068279393 10:54849405-54849427 ATTTATTCACAAAGGAACAGAGG - Intronic
1069228571 10:65976303-65976325 ATTTTATCAGAGTTGTATAGTGG - Intronic
1069584639 10:69590084-69590106 ATTTATTGACAGTTGAATAGGGG + Intergenic
1069978815 10:72237860-72237882 ATTTATGCACAGAAGGCTAGTGG - Intergenic
1071369492 10:84936727-84936749 ATTCTTTCACAGCTGTACAGTGG + Intergenic
1071395702 10:85221765-85221787 ACATATACACAGAGGTATAGAGG + Intergenic
1071785785 10:88898281-88898303 AATCTTTCACAGTTGTATAGTGG - Intronic
1071952761 10:90723774-90723796 ATTTATTTACAAAGGTGTAGAGG - Intergenic
1072747687 10:97952899-97952921 ATATATTCACAGATGTGGAAGGG - Intronic
1072818150 10:98530145-98530167 ATTTCTAGACAGATGTATGGAGG + Intronic
1073383199 10:103097595-103097617 AATTATACACATATTTATAGGGG + Intronic
1074635273 10:115308344-115308366 ATTTAGTCCCAAATGTATAAAGG + Intronic
1076594208 10:131615756-131615778 ATTAATGCACAGGTGTATAGAGG + Intergenic
1077959952 11:7065066-7065088 ATTTATTTGCAAATGTAAAGGGG - Intronic
1079173422 11:18117437-18117459 ATATATATACAGATATATAGTGG - Intronic
1079424955 11:20331420-20331442 ATTTATAGACAGATCTGTAGAGG + Intergenic
1079747159 11:24148150-24148172 ATATAATCACACAAGTATAGTGG - Intergenic
1079831017 11:25267560-25267582 TTTTATTCAGGGATGTTTAGTGG + Intergenic
1081922528 11:46792250-46792272 ATTAATTGACAGATTTATCGAGG + Intronic
1082176502 11:49066191-49066213 ATATTCTCACAGATGTAAAGGGG + Intergenic
1082966131 11:58967765-58967787 ATTTACTCTCCGATGTATATTGG + Intronic
1082974944 11:59062082-59062104 ATTTACTCTCTGATGTATATTGG + Intergenic
1082979368 11:59105816-59105838 ATTTACTCTCTGATGTATATTGG + Intergenic
1086005865 11:82034841-82034863 ATTTATTCCCATATGTTTTGTGG - Intergenic
1086689212 11:89769684-89769706 ATATTCTCACAGATGTAAAGGGG - Intergenic
1086716646 11:90070287-90070309 ATATTCTCACAGATGTAAAGGGG + Intergenic
1087434828 11:98101602-98101624 AGTGATTAACAGATGTACAGAGG + Intergenic
1088530287 11:110800800-110800822 ATTTATTCAAATATTTCTAGGGG - Intergenic
1090148195 11:124351002-124351024 ATATCTTCACACATGTATACAGG - Intergenic
1092044283 12:5417911-5417933 ATTAATTGACAGATGGACAGAGG - Intergenic
1093231804 12:16554492-16554514 ATTTGTTCACAGGTGTATAGTGG - Intronic
1093834693 12:23814066-23814088 ATTTATTTATAGATGTATTTTGG + Intronic
1093844642 12:23954494-23954516 AATGACTCACAGATGTATATTGG - Intergenic
1093953246 12:25188326-25188348 ATTTATGAAAAGATGTACAGTGG + Intronic
1094203492 12:27816715-27816737 TTTTATTCATAGATGTAATGGGG + Intergenic
1095224121 12:39658548-39658570 ATTTATTCAGACTGGTATAGTGG + Intronic
1096945117 12:55397313-55397335 ATATATACACATATGTATATAGG + Intergenic
1097454193 12:59776013-59776035 ATTTATTCACAGTTTTTTTGAGG + Intronic
1097769112 12:63560036-63560058 ATTTCCTCACAGAGGTAAAGAGG + Exonic
1097780726 12:63701484-63701506 ATTTATCCACAGCTTTTTAGAGG - Intergenic
1098349552 12:69543937-69543959 TTTTATTCTCAGAGGAATAGGGG + Intronic
1099313223 12:81053637-81053659 ATTCATACACACATGTATATAGG + Intronic
1099793552 12:87366074-87366096 ATTTATTTACAAAACTATAGTGG - Intergenic
1101927819 12:108987719-108987741 ATTTCTTCAAAGATGTACAAAGG - Intronic
1104126259 12:125849058-125849080 ATTTGTTCACAAATGGAAAGGGG - Intergenic
1104310532 12:127650827-127650849 ATGTATTCTCAGATGTCTGGAGG + Intergenic
1105928527 13:25031202-25031224 ATTTCTTCACAGTTGTATTTAGG - Intergenic
1105973157 13:25449712-25449734 ATTTAATAACAGATATATAATGG - Intronic
1106930447 13:34658371-34658393 ATTTATTCTCATTTTTATAGTGG + Intergenic
1107368249 13:39710215-39710237 ATTTATTCCCAGATATTGAGTGG + Intronic
1108718625 13:53106937-53106959 ATTTATACGCAGTTATATAGGGG - Intergenic
1110945737 13:81413516-81413538 ATTTATTCACAAATGAATAAAGG + Intergenic
1111752631 13:92353789-92353811 ATTTATTACCAGATGTTTAGTGG - Intronic
1112718662 13:102216368-102216390 ATTTATTCACAGCAGGATTGAGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1113410398 13:110081318-110081340 ATTCATTCCCAGAAGTAAAGTGG + Intergenic
1115047751 14:29017983-29018005 ATATATACACACATGTATATAGG - Intergenic
1115925963 14:38435181-38435203 TTTTATGCAAAGAGGTATAGAGG + Intergenic
1116134679 14:40907170-40907192 ATTTACCCAAAGATGTGTAGGGG - Intergenic
1116523660 14:45879099-45879121 ATTTATTCAAATATGTATATAGG + Intergenic
1116556300 14:46313811-46313833 ATATATTCTTAGATGTAAAGTGG - Intergenic
1117308939 14:54502994-54503016 GAGTTTTCACAGATGTATAGAGG - Intergenic
1120348014 14:83315007-83315029 AATCATTCACAGATGAATAAAGG + Intergenic
1120377808 14:83731523-83731545 ATGTCTTCACAGATCTATAGAGG + Intergenic
1120394187 14:83946561-83946583 ATTTACTCACAAAAGTATGGAGG - Intergenic
1120398252 14:83995632-83995654 ATGTATTTAAAGATGTATATAGG + Intergenic
1123663139 15:22583746-22583768 TTATACTGACAGATGTATAGTGG - Intergenic
1123805285 15:23865300-23865322 ATTCATTCACTGATTTATATTGG + Intergenic
1124316941 15:28678049-28678071 TTATACTGACAGATGTATAGTGG - Intergenic
1124566510 15:30819450-30819472 TTATATTGACAGATGTATAGTGG + Intergenic
1124657533 15:31521254-31521276 ATTTATTTAAATATGTTTAGGGG - Intronic
1125177456 15:36841141-36841163 TTTTATTCATAAATGTATAGGGG + Intergenic
1125191844 15:37002558-37002580 ATTTATTCACCAATATTTAGTGG - Intronic
1125268021 15:37906279-37906301 GTTTAATCATAGATGTATAAAGG - Intergenic
1128933059 15:71722923-71722945 TTTCATTCACAAATGTATAATGG + Intronic
1137004945 16:35267189-35267211 ATTTATTCACTTATTTATATTGG - Intergenic
1137753936 16:50886700-50886722 ATTTATTCAAACATGCATATTGG + Intergenic
1138704540 16:58901316-58901338 AGTTATTGAAAGATCTATAGAGG - Intergenic
1138899357 16:61250347-61250369 ATTTTTTCACGGATGTAGTGAGG + Intergenic
1139334209 16:66219783-66219805 GTTTATTGACAGATGTTTAAGGG - Intergenic
1140927326 16:79596785-79596807 ATTTTTTTACAGTTGTATTGTGG - Intronic
1142552255 17:748008-748030 ATTTCTTCACAGATGTTCAAGGG + Exonic
1147491706 17:40874485-40874507 ATTTATCCTCATATGTAAAGTGG + Intergenic
1150068889 17:62135687-62135709 ATTTATTCACTCATTTATTGAGG + Intergenic
1150473091 17:65453954-65453976 ATTTGTTAACAGATGCAAAGCGG - Intergenic
1152383229 17:79952954-79952976 ATTTATTCACAGGTGTTTACAGG - Intronic
1155428759 18:25733693-25733715 ATTTATTGGCAGATGTATGTAGG - Intergenic
1155912356 18:31518583-31518605 ATATATACACAGATGCATAAAGG - Intronic
1156636140 18:39031884-39031906 ATTTATTCACACAGCTATAATGG + Intergenic
1157177743 18:45466794-45466816 ATTCATTCACAGGGGTATACAGG - Intronic
1158008921 18:52706110-52706132 TGTTATTCAGAAATGTATAGAGG + Intronic
1158438185 18:57449308-57449330 ACTTATTCACAGATATTTATTGG - Intronic
1158961234 18:62589165-62589187 ATTTCTGAACAGAAGTATAGAGG + Intergenic
1159120940 18:64169851-64169873 ATTTATTCACATGATTATAGAGG + Intergenic
1162288432 19:9759283-9759305 AATAATTCTCAGATGTATTGTGG - Intronic
1164112505 19:22181754-22181776 AATTATTCACATATGTATTTTGG - Intronic
1164132182 19:22374074-22374096 ATTTATTTACAAATTTAGAGAGG - Intergenic
1164499536 19:28805605-28805627 ATATATACACATATGTATATAGG + Intergenic
1165868075 19:38951091-38951113 GTTTTTTCAAAGATTTATAGGGG + Intronic
1166808561 19:45501325-45501347 AGATATCCAAAGATGTATAGTGG + Intronic
926026457 2:9549424-9549446 ATATATACACATAAGTATAGTGG + Intronic
927033209 2:19143951-19143973 ATTTGTTGACTGATGAATAGAGG + Intergenic
927072026 2:19540735-19540757 TTCTATTTACAGATGTTTAGGGG - Intergenic
927375352 2:22406843-22406865 ATTTACTCACAGTAGTAAAGAGG - Intergenic
927389530 2:22579659-22579681 TTTTATTCACGGATGTAAAGCGG - Intergenic
927444124 2:23142654-23142676 TTTAAATCACAGATTTATAGAGG + Intergenic
928684497 2:33734181-33734203 ATTTATTGACAGATTTCTACCGG - Intergenic
928912463 2:36436318-36436340 ATTTATTGAAAGGTGAATAGAGG + Intronic
929733285 2:44519264-44519286 GTTTATAAACACATGTATAGAGG - Intronic
930272437 2:49272532-49272554 ATTTATTCTCAGCTCTAAAGAGG - Intergenic
930560762 2:52957449-52957471 ATTATTTCACAGTTCTATAGGGG - Intergenic
930671889 2:54160115-54160137 GTTTATTCTCAAATATATAGGGG + Intronic
930813959 2:55572989-55573011 ACATATTCACACATGTATAGAGG - Intronic
933349231 2:81132172-81132194 ATTTCTTCACAGAAATTTAGAGG + Intergenic
934181803 2:89629762-89629784 ATTTATTCACAATTATACAGTGG + Intergenic
934292108 2:91703981-91704003 ATTTATTCACAATTATACAGTGG + Intergenic
935201967 2:100865052-100865074 ATTTTCTCACAAATGTACAGTGG - Intronic
936150332 2:110016208-110016230 AGTTATTCACACAAGTAGAGTGG + Intergenic
936174403 2:110206741-110206763 ATATATTCACACATATTTAGGGG - Intergenic
936194344 2:110355167-110355189 AGTTATTCACACAAGTAGAGTGG - Intergenic
936985591 2:118309245-118309267 ATTTATTCAAAGAGGGATGGTGG - Intergenic
937784161 2:125875782-125875804 ATTTATTCCCAGTTGCATAAAGG + Intergenic
942534065 2:176944649-176944671 ATTTTTTAACAGGTGTATATGGG - Intergenic
942915597 2:181302464-181302486 ACTTATGGACAGATTTATAGAGG - Intergenic
943237823 2:185345896-185345918 ACTAAATCACAGAAGTATAGGGG + Intergenic
944823248 2:203453022-203453044 ATTCTCTCACATATGTATAGTGG - Intronic
945543090 2:211113374-211113396 ATTTATTCTCAGATTTTCAGTGG + Intergenic
946426327 2:219599567-219599589 ATTTATTCAGTGATGAATGGTGG + Intronic
948482201 2:238257256-238257278 GTTTATTCATAGAAGAATAGTGG + Intronic
1169845498 20:9987438-9987460 GTTTATGCACAGAAGTAGAGAGG + Intronic
1169865586 20:10196532-10196554 AATTATTTATAGATGAATAGAGG + Intergenic
1171002781 20:21431434-21431456 ATATATTCACAAATGTATCTTGG - Intergenic
1173635432 20:44552601-44552623 ATTTATATACAGTTGCATAGTGG - Intronic
1177018589 21:15823087-15823109 ACTTATTGACAGATGTGTGGTGG + Intronic
1177504738 21:22005900-22005922 ATTTAGACACAGATGTACAGAGG + Intergenic
1177799302 21:25812204-25812226 ATTTATTTACACATTTATATAGG - Intergenic
1181294998 22:21830674-21830696 ATTTATTCACTTATTTATATAGG - Intronic
949607431 3:5669532-5669554 GTGTATTCATAGATGTATGGAGG - Intergenic
949704172 3:6796891-6796913 CATTATATACAGATGTATAGGGG + Intronic
950143031 3:10628223-10628245 AGTCATTAACAGATGTACAGTGG + Intronic
951047079 3:18051921-18051943 ATTTATTCACAGACAAACAGAGG + Intronic
951110692 3:18800471-18800493 ATATATTAACAAGTGTATAGTGG + Intergenic
951766168 3:26202103-26202125 GTTTGTTCACAGATCTAAAGGGG + Intergenic
952222258 3:31335855-31335877 ATTTATTGGCAAATCTATAGGGG - Intergenic
953496553 3:43392602-43392624 ATTTACTCACATATATATAAGGG - Intronic
955514497 3:59713409-59713431 ATTTGTCCACAGGTGTATAAAGG - Intergenic
955552927 3:60103454-60103476 ATTTCTTCACAAATTTATCGTGG - Intronic
955811364 3:62794045-62794067 ATTTATTCACATGTGTATCTTGG - Intronic
956284165 3:67590966-67590988 AATTATTTACAGTTGTAGAGAGG + Intronic
956916747 3:73880091-73880113 ATTTATTCAAACATGTGTTGAGG + Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
959260579 3:104074610-104074632 AATTTTCCACAGATGTAGAGAGG + Intergenic
959620419 3:108393734-108393756 ATTGATTCACAAATGAAAAGTGG + Intronic
960826900 3:121796771-121796793 ATTTATAAACAGATGTAAATGGG + Intronic
963295260 3:143538834-143538856 ATGTTTTCACAGATCTCTAGGGG + Intronic
963570800 3:146993018-146993040 ATATATACATATATGTATAGAGG + Intergenic
964351484 3:155807352-155807374 ATTTAGTCACATATGGCTAGTGG + Intergenic
964612939 3:158633151-158633173 ATTTGTTCACAAATGTATCGGGG + Intergenic
967071152 3:185963401-185963423 ATTTATTCAAAGAGGTTGAGGGG - Intergenic
970925750 4:21449898-21449920 ATTTATACAGAGATGGAAAGTGG - Intronic
971587344 4:28421582-28421604 ATTGATTCACAGTTCCATAGGGG + Intergenic
971898248 4:32624245-32624267 ATTTGGTAACAGAGGTATAGGGG + Intergenic
972040074 4:34582649-34582671 ATTTATTCAGAGATTTATTGAGG + Intergenic
972626107 4:40800638-40800660 AGTTATTCAAAAATGTTTAGGGG - Intronic
974288674 4:59902998-59903020 ATATATTCAGAGTTGTATTGAGG - Intergenic
975200312 4:71580558-71580580 TTTTATACACAGATTTATACTGG - Intergenic
975519515 4:75284959-75284981 GTTTATGCATAGATGTATATAGG + Intergenic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
977298078 4:95233159-95233181 ATTAATTCTCAGAAGTACAGAGG - Intronic
978543466 4:109843971-109843993 ATTTATCCAGAGATGTAAATTGG + Intronic
978622623 4:110649112-110649134 ATTTATGCACACATTTATACAGG - Intergenic
979471652 4:121105934-121105956 ATTTATTCATGGCTGTATGGGGG + Intergenic
980295128 4:130904185-130904207 ATTTATTAAAAAATGTATAATGG - Intergenic
980602874 4:135047599-135047621 ATTTATTCACAGATGATGTGGGG - Intergenic
983455805 4:167962981-167963003 ATATATTCTCAGTTGTACAGAGG + Intergenic
983735005 4:171046249-171046271 ATTAAATCTCAGTTGTATAGCGG + Intergenic
987079471 5:14413399-14413421 ATTTATTCTCAGATATGTATTGG + Intronic
987208789 5:15657459-15657481 ATTTATTCACTGACTTATAATGG - Intronic
987587197 5:19871068-19871090 TTTTATCCACAGATGTGCAGAGG + Intronic
987740335 5:21899660-21899682 ATTTATAAAGAAATGTATAGAGG + Intronic
987910093 5:24131621-24131643 ATTTATTTAAGGATGTGTAGGGG + Intronic
989453670 5:41616688-41616710 ATTAATTCACAGATCTCTAGAGG - Intergenic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
990938938 5:61180961-61180983 AGTTACTCACAAATGTAAAGTGG + Intergenic
994618033 5:102130976-102130998 ATTTACTCACAGATGTAAAGAGG - Intergenic
995172008 5:109125443-109125465 ACTTAGTCACAGATGTTTACAGG - Intronic
996125275 5:119718943-119718965 ATTTATTCAGAGATTTTTAGTGG - Intergenic
996226324 5:121002145-121002167 TTTTATTCAAAGATTTACAGAGG - Intergenic
996596687 5:125211206-125211228 ATGTATTCACATATGTGTTGGGG + Intergenic
999472857 5:151871361-151871383 GTTTATTCACAGATATTTTGTGG - Intronic
999902871 5:156105337-156105359 ATTTGTTCACTGATTTATACAGG - Intronic
1001852832 5:174984558-174984580 ATTCATTCACACATATATACAGG + Intergenic
1002113775 5:176940886-176940908 ATTATTTCACAGATGCATAAAGG + Intronic
1003124244 6:3342828-3342850 GTTTAATCACATATGTATACCGG + Intronic
1005792370 6:29317210-29317232 AATTTTTCAGAAATGTATAGTGG - Intergenic
1007015975 6:38467020-38467042 ATTTATTGACTGAAGTTTAGTGG - Intronic
1007888900 6:45266754-45266776 ATTTTTTCACATATTTACAGAGG + Intronic
1008424456 6:51340724-51340746 ATATATACACACATGTATAAAGG + Intergenic
1010200019 6:73274246-73274268 ATTTTTGCAAATATGTATAGCGG + Intronic
1011688870 6:89847047-89847069 ATTAATTCATTTATGTATAGAGG - Intronic
1012013291 6:93820976-93820998 ATTTAGTCATAGATTTATAATGG - Intergenic
1012992088 6:105936266-105936288 ATTTCTTCACAGATGCATGAAGG + Intergenic
1014188588 6:118465004-118465026 CTTTATTCACAAATTTATAAGGG - Exonic
1014608062 6:123503507-123503529 ATGTGTTCACAGATCTAAAGGGG - Intronic
1015015105 6:128403331-128403353 CCTTATTCATAGATGTATAAGGG - Intronic
1015063277 6:128994852-128994874 CTTTATTCACCGAGGTATATAGG - Intronic
1015695647 6:135976950-135976972 ATATCTGGACAGATGTATAGAGG - Intronic
1016171823 6:141026985-141027007 ATTTTTTCACAGATGTTTGGTGG - Intergenic
1016754867 6:147674007-147674029 ATTTATTCACAGTTGTTCAATGG + Intronic
1018523187 6:164676366-164676388 ATATAGTCAAAGATATATAGAGG - Intergenic
1019767263 7:2860827-2860849 ATTTAATCACACATGAATGGAGG + Intergenic
1021292481 7:18863583-18863605 CTTTGTTCACAGATGTATTTTGG - Intronic
1022928389 7:35081114-35081136 ATTTGCTCACAGAGGTAAAGAGG + Intergenic
1022939311 7:35217536-35217558 ATTTATCCACAGCTTTTTAGAGG - Intronic
1023286783 7:38629635-38629657 ATTCCTTCACAGATGGAAAGTGG + Intronic
1027822440 7:83064069-83064091 ATTTATTCACTTTTATATAGAGG - Intronic
1027943261 7:84712069-84712091 CTTTATTCACAGATGAAGTGTGG - Intergenic
1027980452 7:85213612-85213634 ATTTCTTCACAGATGGATAAAGG + Intergenic
1028485632 7:91354530-91354552 ACATATACACTGATGTATAGGGG - Intergenic
1028746277 7:94330283-94330305 ATTTACTCTTAGATGTCTAGCGG - Intergenic
1028981979 7:96977363-96977385 ATTTATTCACATATGGAAGGTGG + Intergenic
1030362118 7:108606080-108606102 ATTTATTCAGATATGTAACGAGG - Intergenic
1031342627 7:120622778-120622800 GTTTAGCCACAGATGTATACAGG - Intronic
1031346831 7:120677229-120677251 ATTTATTCACAGATTTTTTTTGG - Intronic
1031956806 7:127950758-127950780 ATTAAATCTCAGATGTATATAGG + Intronic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1032160530 7:129506093-129506115 ATTTCTTAACAGATTTATTGAGG + Intronic
1032797563 7:135289906-135289928 ATTTATACACATATACATAGTGG - Intergenic
1033295084 7:140125481-140125503 ATTTAGTCACACATGGCTAGTGG + Intronic
1035834925 8:2739920-2739942 ATATATTCACAGATGTGTTGAGG - Intergenic
1038631187 8:29245808-29245830 GTTTATTCTCAGATTTTTAGCGG - Intronic
1040653795 8:49480627-49480649 TTTCATTCACAGATGTTTAAAGG - Intergenic
1040980886 8:53245305-53245327 ATTAAGACACAGATGTGTAGGGG + Intronic
1042493032 8:69423210-69423232 ATATATACACACATGTAGAGGGG - Intergenic
1042746354 8:72111588-72111610 ATTTGTTCACTGATGGATACAGG + Intronic
1043251564 8:78080291-78080313 ATTTTGTCAGAGATGTATATTGG + Intergenic
1044004871 8:86927871-86927893 AATAATTCACAGGTGTATCGAGG + Intronic
1046935944 8:119885835-119885857 ATTAATTGACAGATGGATAGAGG - Intronic
1047343654 8:124006485-124006507 ATATGTGCACACATGTATAGGGG - Intronic
1048064984 8:130958188-130958210 ATTTATTCACATATTTTTTGTGG - Intronic
1048214655 8:132482804-132482826 ATCTATTCACGGATGTACAGGGG - Intergenic
1049845108 8:144796854-144796876 ATTTAATCACACATGTGAAGGGG - Intergenic
1050102365 9:2132234-2132256 ATTTCCTCACAGGTGTAAAGAGG + Intronic
1050792945 9:9496792-9496814 ATTTATACACCCATGTTTAGTGG + Intronic
1051289257 9:15528714-15528736 AATTATTTAAAGATGTTTAGGGG + Intergenic
1052369003 9:27643611-27643633 ATATATACACATATGTATATGGG - Intergenic
1052914635 9:33915284-33915306 ATTTATTCAGAGAAGTAAAATGG + Intronic
1056673940 9:88656944-88656966 ATTTCCTCACAGAGTTATAGTGG + Intergenic
1057608330 9:96518084-96518106 ATTTGGTCACAGATGTATCCAGG - Intronic
1059163326 9:112055755-112055777 ATTTATTCATGGATGAATAATGG - Intronic
1060317122 9:122522457-122522479 ATTTTGTCACAGATGGAAAGTGG + Intergenic
1060648037 9:125299143-125299165 ATTTATTTACAGAATCATAGTGG - Intronic
1061917348 9:133762330-133762352 TATTATTCACAGATATATAACGG + Exonic
1185559944 X:1052249-1052271 ATTCATTCACAGATGGGTATTGG - Intergenic
1186067299 X:5779577-5779599 ATTTATTCATAAATGTTTAGTGG - Intergenic
1186363319 X:8865538-8865560 ATTTGTTGATAGATGTATATAGG + Intergenic
1186724989 X:12348033-12348055 ATTTATGAACAGTTGTTTAGTGG + Intronic
1187890684 X:23932047-23932069 ATTTTTTCACAGCTTTATTGAGG - Intronic
1192491839 X:71582660-71582682 ATTTATGCACTCATGTATATGGG - Intronic
1195134089 X:101886262-101886284 ATTTTTCCAGTGATGTATAGTGG - Intronic
1195521904 X:105840314-105840336 ATATGTTCACAGATATATATTGG + Intronic
1196627496 X:117893285-117893307 ATTTCCCCACAAATGTATAGTGG - Intergenic
1197842599 X:130764841-130764863 ATTTAATGAAAGATGTTTAGTGG + Intronic
1198364724 X:135929085-135929107 TTTTGCTCACAGATGTGTAGGGG - Intergenic
1200417879 Y:2931699-2931721 ATTTTTCCACAGGTGTACAGTGG + Intronic
1201366107 Y:13208070-13208092 ATTTATTGACTTATATATAGAGG + Intergenic
1201453548 Y:14143082-14143104 ACTTATTCACAGTTATATAAAGG - Intergenic
1201574024 Y:15442952-15442974 ATTTATAGACAGATGTCTACAGG - Intergenic
1202195130 Y:22292291-22292313 ATTTTTTCACTGAGGTCTAGTGG + Intergenic