ID: 1064488155

View in Genome Browser
Species Human (GRCh38)
Location 10:15819444-15819466
Sequence TGGGAGACCTATAATGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064488155_1064488162 6 Left 1064488155 10:15819444-15819466 CCACTACCATTATAGGTCTCCCA 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1064488162 10:15819473-15819495 AGGGATCACCCTAATCACCCTGG No data
1064488155_1064488163 13 Left 1064488155 10:15819444-15819466 CCACTACCATTATAGGTCTCCCA 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1064488163 10:15819480-15819502 ACCCTAATCACCCTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064488155 Original CRISPR TGGGAGACCTATAATGGTAG TGG (reversed) Intronic
908554500 1:65244008-65244030 AGGGAGACCTAAAATGGGGGAGG + Intergenic
908824267 1:68118009-68118031 TGGGTGACCTATTATCTTAGGGG + Intronic
910304191 1:85742725-85742747 TGAGAGAACTAGAATGGTAAAGG - Intronic
911316346 1:96361148-96361170 GGGGATAGCCATAATGGTAGTGG - Intergenic
914045602 1:144089332-144089354 TTGATGACCGATAATGGTAGAGG - Intergenic
914132508 1:144871354-144871376 TTGATGACCGATAATGGTAGAGG + Intergenic
919557168 1:199072512-199072534 TGGGAGACATTTGAAGGTAGGGG + Intergenic
1064488155 10:15819444-15819466 TGGGAGACCTATAATGGTAGTGG - Intronic
1065610057 10:27463855-27463877 GGGGACACCTGTGATGGTAGTGG + Intergenic
1067654675 10:48182385-48182407 TGGGAGACCTTTTTTGGTAAAGG + Intronic
1072563454 10:96598001-96598023 TTGCAGACCTATAATTATAGTGG + Intronic
1077207527 11:1352045-1352067 TGGGAGGCCTAGAAGGGGAGTGG - Intergenic
1077207702 11:1352463-1352485 TGGGAGGCCTAGAAGGGGAGTGG - Intergenic
1082045539 11:47723063-47723085 TGGTGGTTCTATAATGGTAGCGG + Exonic
1086540780 11:87909082-87909104 TAAGAGGCATATAATGGTAGAGG - Intergenic
1087299607 11:96416730-96416752 TGGAAGATCTATTATTGTAGTGG - Intronic
1089650373 11:119909024-119909046 TGGGAGAGCCATGAGGGTAGAGG - Intergenic
1091916867 12:4275990-4276012 TCACAGACCTATAATGGGAGTGG - Exonic
1095278406 12:40319077-40319099 TGGGAGATCTATAATGTTTAAGG - Intronic
1097472016 12:60005277-60005299 GGGGAGACTTGCAATGGTAGAGG - Intergenic
1101446744 12:104742334-104742356 TGGGAGGCCCATCGTGGTAGGGG + Intronic
1105991455 13:25626421-25626443 TGGGACCCCTACAATGGTACTGG - Intronic
1106926676 13:34620616-34620638 AGGGAGACCTATAATGACTGGGG - Intergenic
1108981480 13:56521335-56521357 TGGGAGGCCTGTGATGGGAGGGG - Intergenic
1109627361 13:64993201-64993223 TGTGAGGCCTAAAATGGTTGCGG - Intergenic
1119121046 14:72077963-72077985 TGGGAGAAAAATACTGGTAGAGG - Intronic
1119492711 14:75050861-75050883 GGGGAGACCTTTAATGGCACTGG - Intronic
1122452871 14:101825302-101825324 TGGGAGACATATACTGATAATGG + Intronic
1128421263 15:67493377-67493399 AGGGAGCCCTATAATGCTACAGG + Intronic
1131723703 15:95200489-95200511 TGGGAAACCTACAATCGTAGTGG - Intergenic
1136931120 16:34418718-34418740 TGGGAGAACAAAAATGGGAGAGG - Intergenic
1136973453 16:34993090-34993112 TGGGAGAACAAAAATGGGAGAGG + Intergenic
1153352102 18:4092492-4092514 TAGGAGACATCTAATGGTATTGG + Intronic
1154961222 18:21310916-21310938 TTGGAGACCCATTATTGTAGAGG + Intronic
1155072900 18:22331772-22331794 TGGGAGATCAATAATGGATGGGG + Intergenic
1157283124 18:46359097-46359119 TGGGAGCCCTATGAAGGAAGTGG - Intronic
1159195694 18:65111042-65111064 AGGGAGATGGATAATGGTAGAGG - Intergenic
1164398128 19:27883897-27883919 TGGAAGTCCTATGATGGGAGTGG + Intergenic
1167642125 19:50687717-50687739 TGGGAGCCCTGTGGTGGTAGAGG - Intronic
1202685160 1_KI270712v1_random:42738-42760 TTGATGACCGATAATGGTAGAGG - Intergenic
925863947 2:8207779-8207801 TGGGTAAGCTATAATGATAGAGG + Intergenic
926162569 2:10499206-10499228 TGTGAGACCTTTGCTGGTAGAGG - Intergenic
928505219 2:31944638-31944660 TAGGAGACCTATAATAGTTATGG - Intronic
929042339 2:37757553-37757575 AGAGAGACCTATAATGCTAATGG - Intergenic
933004155 2:76968988-76969010 TGGGAGGCCAATAAAGGCAGCGG - Intronic
934246561 2:90312117-90312139 TTGATGACCGATAATGGTAGAGG + Intergenic
937856125 2:126673059-126673081 TGGGAGACCCAGAAGGGTATTGG + Intronic
938958206 2:136318168-136318190 TGGGAGCCCTTCAGTGGTAGGGG - Intergenic
941431982 2:165424092-165424114 CAGGAGACCTATAATCATAGTGG + Intergenic
945403767 2:209421757-209421779 TGGGAGACAGATAATGCTGGAGG - Intergenic
1173184313 20:40829121-40829143 TGGGATAACTAGAATGGCAGGGG - Intergenic
1176476566 21:7220367-7220389 TTTGAGACCTATTATGGTAAAGG - Intergenic
1178885437 21:36481127-36481149 TGGGAAACCTCTAAGGATAGAGG - Intronic
1180872113 22:19152046-19152068 TGGGAGAACTTTATTGGTAGTGG - Intergenic
959679323 3:109074960-109074982 TGGGAGAGCTTTAATTCTAGTGG - Intronic
967205706 3:187118884-187118906 TGGGAAAGCTATGATGGAAGAGG - Intergenic
970785843 4:19794947-19794969 TGGCAGACATAGAATGATAGGGG - Intergenic
982181996 4:152757118-152757140 TTTGAGACCGATAAAGGTAGAGG - Intronic
982609608 4:157557269-157557291 TGGGAGCCCAATAATAGAAGTGG - Intergenic
983440727 4:167780747-167780769 TGAGAGACCTTTAATGGCACTGG - Intergenic
995820919 5:116231400-116231422 TTGGAGAACAAAAATGGTAGAGG + Intronic
997147106 5:131447160-131447182 TGGGCCTGCTATAATGGTAGTGG - Intronic
999434495 5:151552888-151552910 TAGGAGACCTAAAATGGTTCAGG - Intronic
1007936272 6:45735324-45735346 TAAGAAACCTATATTGGTAGGGG - Intergenic
1010283808 6:74051303-74051325 TAGGAGACCTTTAATAGTACTGG + Intergenic
1015131749 6:129819072-129819094 TGGGAGGCCTATAAAGGAAAGGG + Intergenic
1015715095 6:136184310-136184332 TGGAAAACCTCTAATGATAGTGG + Intronic
1023128545 7:36979103-36979125 TGGGTGGCCTTTAATGCTAGAGG + Intronic
1033487218 7:141802653-141802675 TATGATAGCTATAATGGTAGGGG + Intergenic
1036489360 8:9210757-9210779 TGGAAGACCTACAATGAAAGAGG - Intergenic
1038047697 8:23780084-23780106 TGGGGGATGTATAGTGGTAGAGG - Intergenic
1042661082 8:71155245-71155267 TTGAATTCCTATAATGGTAGAGG + Intergenic
1042842014 8:73133495-73133517 AGGGTGACCTGTGATGGTAGTGG + Intergenic
1047379629 8:124347421-124347443 TTGGAGACTTAGAATGGAAGAGG + Intronic
1048367992 8:133755244-133755266 TATGAGAGCTATAATGGTCGGGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1055527350 9:77148275-77148297 TTGGAGACCTGCAATTGTAGAGG - Intergenic
1061976424 9:134070215-134070237 TGGGAGGCCCATAAGGGTTGGGG - Intergenic
1203412000 Un_KI270579v1:23053-23075 TTTGAGACCTATTATGGTAAAGG - Intergenic
1186939875 X:14494669-14494691 TGGGAAAACTAGAATGGAAGTGG + Intergenic
1189223009 X:39388838-39388860 TGGCAGGCCTATAATTATAGTGG + Intergenic
1200243146 X:154508184-154508206 TGGGAGATCTTGAATGGGAGGGG + Intronic
1202588467 Y:26456871-26456893 TTGATGACCGATAATGGTAGAGG + Intergenic