ID: 1064491400

View in Genome Browser
Species Human (GRCh38)
Location 10:15860719-15860741
Sequence GAGCAGTGCGTAGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064491400_1064491405 -7 Left 1064491400 10:15860719-15860741 CCTTCTTCCTCTACGCACTGCTC 0: 1
1: 0
2: 3
3: 25
4: 249
Right 1064491405 10:15860735-15860757 ACTGCTCTGGGCTAAGCTGGAGG No data
1064491400_1064491404 -10 Left 1064491400 10:15860719-15860741 CCTTCTTCCTCTACGCACTGCTC 0: 1
1: 0
2: 3
3: 25
4: 249
Right 1064491404 10:15860732-15860754 CGCACTGCTCTGGGCTAAGCTGG No data
1064491400_1064491406 1 Left 1064491400 10:15860719-15860741 CCTTCTTCCTCTACGCACTGCTC 0: 1
1: 0
2: 3
3: 25
4: 249
Right 1064491406 10:15860743-15860765 GGGCTAAGCTGGAGGCTCTGAGG No data
1064491400_1064491408 14 Left 1064491400 10:15860719-15860741 CCTTCTTCCTCTACGCACTGCTC 0: 1
1: 0
2: 3
3: 25
4: 249
Right 1064491408 10:15860756-15860778 GGCTCTGAGGCCCAGGCACTAGG No data
1064491400_1064491407 7 Left 1064491400 10:15860719-15860741 CCTTCTTCCTCTACGCACTGCTC 0: 1
1: 0
2: 3
3: 25
4: 249
Right 1064491407 10:15860749-15860771 AGCTGGAGGCTCTGAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064491400 Original CRISPR GAGCAGTGCGTAGAGGAAGA AGG (reversed) Intergenic
900276557 1:1833404-1833426 GAGCGGTGCGTAAGGGAAGCAGG - Intronic
900800821 1:4735940-4735962 GAGCAGAGCTTAGAGGAAGAGGG + Intronic
901396915 1:8988443-8988465 AAGCAGTGCATAGAGGAAACAGG - Intergenic
901817041 1:11800289-11800311 GACCAGTGGGAAGAGGAGGAGGG - Exonic
902217292 1:14942341-14942363 GTGGAGTGCGGAGAGGAAAAAGG + Intronic
902733022 1:18382431-18382453 GAGCAGGGCTTTGGGGAAGAAGG - Intergenic
902785503 1:18730492-18730514 CAGCAGGGTGCAGAGGAAGAGGG - Intronic
903018703 1:20378679-20378701 GAGGAGTGAGAAGAGAAAGAGGG - Intergenic
903676869 1:25069897-25069919 GAGCAAGGCCTAAAGGAAGATGG - Intergenic
904009654 1:27382553-27382575 GAGCACTGCGTGGAGGGAGACGG - Exonic
904718138 1:32484741-32484763 GAGCAGGGGGAAGAGAAAGAAGG - Intronic
905218301 1:36425963-36425985 GAGCTGAGCCTGGAGGAAGAAGG + Intronic
905840098 1:41169399-41169421 GAGCAGTGCAGAAAGGAAGTAGG - Intronic
908046547 1:60176503-60176525 GAGCAATGGGTAGAGGATGATGG - Intergenic
908635437 1:66158940-66158962 GGGTAGTGGGTAAAGGAAGATGG + Intronic
910467740 1:87518060-87518082 GAGCAATGCAAAGAGGAACAGGG + Intergenic
912754800 1:112315065-112315087 GCGCAGTGGGGAGAAGAAGAGGG + Intergenic
914407473 1:147390047-147390069 CAGCAGTGCTTAGGGGAAGAGGG - Intergenic
918126094 1:181585282-181585304 GAGGAGAGAGTAGAGGGAGAGGG + Intronic
920564128 1:206960330-206960352 GAGAAGTGAGCAGAGGGAGAGGG + Intronic
920714163 1:208323891-208323913 GAGCCATGTGTAGATGAAGAAGG + Intergenic
921049895 1:211503825-211503847 GAGCCTGGCGTAGAGGCAGAAGG + Intergenic
921665134 1:217860044-217860066 AAGCAGTGCCTAGAGGAAAATGG - Intronic
921887661 1:220322665-220322687 GAGCAGTCCTTCCAGGAAGAGGG - Intergenic
922754485 1:228088020-228088042 GTGCAGTGCCCAGCGGAAGAGGG + Intronic
923397062 1:233576632-233576654 AGGCAGTGGGTAGAGGATGAAGG - Intergenic
923538210 1:234869345-234869367 GAGCAGTGCCTGGAGGAAGCAGG - Intergenic
923827444 1:237515930-237515952 GAGCAAGGAGAAGAGGAAGAAGG - Intronic
1062844817 10:695911-695933 GAGCAGTGCGTCCAGGCGGATGG + Intergenic
1063920667 10:10929084-10929106 GAGCAGTGAGAAGAGTGAGAAGG - Intergenic
1064491400 10:15860719-15860741 GAGCAGTGCGTAGAGGAAGAAGG - Intergenic
1065929621 10:30468199-30468221 GGGGAGTGTATAGAGGAAGAGGG - Intergenic
1066254350 10:33664134-33664156 GACCAGTGTGCAGAGGCAGATGG + Intergenic
1067165919 10:43866526-43866548 GAGCAGTGCGCAGGGGAACCAGG - Intergenic
1067176874 10:43956322-43956344 GAGCAGGGCATGGAGGAGGAGGG + Intergenic
1070518605 10:77231242-77231264 GATCAGTGAGTAGAGCAAGTAGG - Intronic
1070809579 10:79290896-79290918 AGGCAGTGTGGAGAGGAAGAGGG - Intronic
1071748536 10:88448998-88449020 GTGCAGTGCGGGGAGGGAGAAGG + Intronic
1072570980 10:96657255-96657277 GAGGAGTGAGGAAAGGAAGAAGG + Intronic
1075491424 10:122873764-122873786 GAGCAGTGCTTACAGGGAAACGG - Intronic
1076804250 10:132847266-132847288 GAGCTGGAGGTAGAGGAAGAGGG - Exonic
1076886393 10:133264731-133264753 GAGCCGGGCGTGGAGGTAGATGG - Intronic
1076886436 10:133264930-133264952 GAGCTGCGCGTGGAGGTAGATGG - Intronic
1076886452 10:133265009-133265031 GAGCCGGGCGTGGAGGTAGATGG - Intronic
1076886461 10:133265049-133265071 GAGCTGGGCGTGGAGGTAGATGG - Intronic
1076886487 10:133265168-133265190 GAGCTGGGCGTGGAGGTAGATGG - Intronic
1076886496 10:133265208-133265230 GAGCTGGGCGTGGAGGTAGATGG - Intronic
1077060273 11:614891-614913 GCGCAGTGCGCAGCGGAAGTTGG + Exonic
1077877757 11:6321885-6321907 GTTCAGTGAGAAGAGGAAGAGGG - Intergenic
1077955942 11:7020184-7020206 GAGCTGTGCTTGAAGGAAGAGGG - Exonic
1079900447 11:26176627-26176649 GAAAAGTGGGAAGAGGAAGATGG - Intergenic
1082813023 11:57490004-57490026 GAGCAGAGGGTAGAGGAGGAAGG + Intronic
1087149833 11:94849412-94849434 GAGCAGTCTGTATAGGACGATGG + Intronic
1087240860 11:95776660-95776682 AATCAGTGCTTTGAGGAAGAAGG + Intronic
1089157503 11:116413758-116413780 GAGCTGAGCGTAGGGGCAGAAGG - Intergenic
1089309242 11:117547054-117547076 GAGGAGTGGGGAGAGGGAGAGGG + Intronic
1090033155 11:123224863-123224885 GAGAAGTGGGTAGAGAAAGGAGG + Intergenic
1090748485 11:129726078-129726100 CAGTGGTGGGTAGAGGAAGAAGG - Intergenic
1092791977 12:12078295-12078317 AAGCAGAGGGTAGAGGGAGAAGG + Intronic
1092792175 12:12079717-12079739 GAGCAGTGCTTGGAGCATGAAGG + Exonic
1093757989 12:22874202-22874224 GAGAAGGGTGTAGAGAAAGAAGG - Intergenic
1094276031 12:28676128-28676150 AAGCAGTGTGTAGAGGGAAAAGG - Intergenic
1095946956 12:47758986-47759008 GAGGAATGCGTAGGGGAAGGGGG + Intronic
1096226992 12:49872400-49872422 GAGAAGTGGATAGAGGAGGAAGG + Intronic
1096873195 12:54607653-54607675 GATGAGGGTGTAGAGGAAGAGGG + Intergenic
1097282654 12:57854231-57854253 GAGCAGAGGGAAGGGGAAGAAGG + Intergenic
1097282668 12:57854274-57854296 GAGGAGTGCGAGGAGGGAGAGGG + Intergenic
1098316527 12:69199125-69199147 GAGAAGTGGGAGGAGGAAGAGGG + Intergenic
1098563494 12:71904246-71904268 GACCATTGCATAGAGGAATAAGG + Intronic
1099355818 12:81633834-81633856 GAGCAGGGGGGAGAGGAAGGTGG + Intronic
1099905103 12:88761924-88761946 GGGCACTGCCTAGTGGAAGAGGG - Intergenic
1101877779 12:108607016-108607038 GAGCGGAGGGGAGAGGAAGAGGG - Intergenic
1102411021 12:112718770-112718792 TAGCCCTGCATAGAGGAAGATGG + Intronic
1102717931 12:114990245-114990267 GAGCAGGGCCTGAAGGAAGAGGG + Intergenic
1105618624 13:22045508-22045530 GACCAATGAGTGGAGGAAGATGG + Intergenic
1105662120 13:22508185-22508207 GAGCAGAGCAAAGAGGAAAATGG - Intergenic
1109842612 13:67939437-67939459 CAGCAGTGCGTAGAAGACAAAGG + Intergenic
1111769256 13:92575685-92575707 CAGCAGTGCTGAGAGGAATATGG - Intronic
1112188152 13:97147905-97147927 GAGTAGTGGGAAGAGGAAGGCGG + Intergenic
1115995572 14:39192441-39192463 CAGCAGTGTGTGTAGGAAGAGGG + Intergenic
1117181994 14:53200649-53200671 GGGCACTGCCTAGTGGAAGAGGG + Intergenic
1118495830 14:66307421-66307443 GAGCAGTGAGTGGAGGAGAAGGG + Intergenic
1119161698 14:72458242-72458264 GAACAGTGCATAGAGAGAGAAGG - Intronic
1122764208 14:104054288-104054310 GAGCAGTGGGTAGAGGCAGATGG + Intergenic
1122873120 14:104650560-104650582 GAGCGGGGCGCAGGGGAAGAGGG + Intergenic
1123097666 14:105774089-105774111 GAGCAGGGCTCAGTGGAAGATGG - Intergenic
1124148876 15:27159079-27159101 GAGGAGGGCGTGGAGGAAGAGGG - Intronic
1127993363 15:64136952-64136974 GAGCAGGCAGTAGAGGATGAAGG - Intronic
1129305422 15:74657492-74657514 GAGCAGTGCGTGGAGTAAACGGG + Intronic
1131827308 15:96331756-96331778 GAGCAGAACGTGGAGAAAGAGGG - Exonic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134687633 16:16169785-16169807 GAAGAGTGCGTAGAGGCAGAGGG + Exonic
1134771371 16:16812344-16812366 GAGAAGAGGGGAGAGGAAGAGGG + Intergenic
1135069116 16:19337057-19337079 GAGCAGTGCCCAGAGGCAGTGGG - Intergenic
1136549892 16:30977399-30977421 GAGCAGTTCTCAGAGGAAGGTGG + Intronic
1137413990 16:48255431-48255453 GAGCAGTGCCCAGAAGAAAAGGG + Intronic
1138030465 16:53555762-53555784 GAGCAGTGAATAGGGGAATATGG + Intergenic
1142105148 16:88298700-88298722 GAGGAGTGGGGAGAGGAAGGTGG - Intergenic
1142132903 16:88438906-88438928 GAGCAGTACGAAGAGGAAAAAGG + Exonic
1142387986 16:89778955-89778977 GAGCAGGGCGGGGAGGAAGTGGG + Exonic
1143580062 17:7820274-7820296 GGACAGTGGGTAGAGGCAGAAGG - Intronic
1144521914 17:15958487-15958509 GAGCACTGGGTAAAGGAAGGAGG - Intronic
1145359853 17:22203092-22203114 GAGAAGTGCATAGAGGAGAAGGG + Intronic
1146633964 17:34490702-34490724 GAGGAGTGTTTAGGGGAAGAGGG - Intergenic
1146941209 17:36845576-36845598 TAGCAGTGCTGAGAGGAGGAAGG + Intergenic
1147609554 17:41793529-41793551 GAGCCTTGGGAAGAGGAAGAAGG + Intergenic
1148223791 17:45883924-45883946 GAGCAGTGCACAGAGGTAGTCGG + Intergenic
1148977529 17:51542741-51542763 CAGCAGGGGGAAGAGGAAGAGGG + Intergenic
1150216765 17:63475718-63475740 GGGCGGTGGGGAGAGGAAGAAGG - Intergenic
1151436757 17:74102498-74102520 GAGGAGTGTGTGGAGGAGGAAGG - Intergenic
1151472866 17:74328605-74328627 GTTCAGTGAGTAGAGGAAGGAGG - Intronic
1152926284 17:83089216-83089238 GAGCAGTGGGTAGGGGTGGAGGG - Intronic
1153189438 18:2521643-2521665 GGGCAGTCCGTGGAGGAATAAGG - Intergenic
1153598755 18:6757319-6757341 GGGCAGTGTTTAGAGAAAGAAGG + Intronic
1154089464 18:11344054-11344076 GTGCAGAGGGTAGAGGGAGAGGG - Intergenic
1156673499 18:39499454-39499476 GTGCAGGGAGTAGAGGAGGAAGG + Intergenic
1157038416 18:44006591-44006613 GAGCAGTGTGAGGAAGAAGAGGG + Intergenic
1157938787 18:51902789-51902811 CAGCAGAGCACAGAGGAAGATGG - Intergenic
1158271934 18:55726037-55726059 GAGCAGTGCCTAGAGCCAGAGGG + Intergenic
1159231411 18:65611741-65611763 GAGTAGAGCATAGAGGATGAAGG - Intergenic
1159338663 18:67104794-67104816 GAGAAGTGCGATGAAGAAGAAGG - Intergenic
1161007009 19:1941865-1941887 GAGCACTGGGTGGGGGAAGAAGG - Intronic
1162316532 19:9942198-9942220 GAGAAGTGGGTGGTGGAAGAAGG + Intergenic
1163016411 19:14458159-14458181 CAGCAGGGCCTAGAGGAGGAGGG + Intronic
1164441756 19:28284702-28284724 GAGGAGTGTGGAGAGGAAGGAGG + Intergenic
1165269118 19:34689612-34689634 GAGCAGTGAGCAAAGGAAGATGG + Intergenic
1165275537 19:34747937-34747959 GAGCAGTGAGCAAAGGAAGATGG + Intergenic
1165941018 19:39414852-39414874 GGGCAGTGGGGAGAGGAGGAAGG + Intronic
1166979292 19:46623414-46623436 GAGGAGTGGGGAGAGGAGGAGGG - Intronic
1168137431 19:54360759-54360781 GAGGTGTGTGCAGAGGAAGAAGG + Intronic
1168160646 19:54508323-54508345 GAGGTGTGTGCAGAGGAAGAAGG - Intronic
1168582933 19:57570351-57570373 GACCTGTGGGTAGAGGGAGAAGG + Intergenic
925237647 2:2293462-2293484 GAGCAGGGCGTGGAGGGTGATGG + Intronic
931205370 2:60140918-60140940 GAGGAGGGGGAAGAGGAAGAGGG - Intergenic
931653582 2:64490095-64490117 GAACAGTCCGTACAGGAGGACGG + Intergenic
931912131 2:66911527-66911549 AAGCAGTGTGTAGAGGGAAATGG - Intergenic
934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG + Intergenic
934904530 2:98187178-98187200 GAGCAGAGAGCAGAGAAAGAGGG - Intronic
936686251 2:114829969-114829991 CAGCAGAGCTTAGAGGAAAATGG - Intronic
938320110 2:130356614-130356636 CAGCAGGGCGAAGAGGAACACGG + Intronic
938391426 2:130909511-130909533 GAGGAGTGAGGAGAGGCAGAAGG + Intronic
942498005 2:176559748-176559770 GAACTGTGATTAGAGGAAGAAGG + Intergenic
944301683 2:198131052-198131074 GAGTAGTGCATGGAAGAAGAAGG - Intronic
944877100 2:203973345-203973367 CCCCAGTGTGTAGAGGAAGATGG - Intergenic
945944293 2:215980176-215980198 AAGCAGTGCCTGGAGGAAAAGGG - Intronic
946435110 2:219646208-219646230 GAGCAGTTGGCAGAGAAAGAAGG + Intergenic
948283983 2:236769837-236769859 GAGCAGTGGGGGGAGGAGGATGG - Intergenic
948566030 2:238886823-238886845 AAACAGAGCGAAGAGGAAGAGGG + Intronic
1169388954 20:5173916-5173938 GTGCAGTTCAAAGAGGAAGAGGG + Intronic
1169933540 20:10858707-10858729 GAGCAGGGTATAGAGGAGGATGG + Intergenic
1170053606 20:12174505-12174527 GAGCAGTTCTAAGAGGAAGCAGG - Intergenic
1172038688 20:32028766-32028788 GAGGAGATAGTAGAGGAAGAAGG + Intronic
1172115804 20:32572827-32572849 GGGCAGTGGGCAGAGGTAGAAGG - Intronic
1172404156 20:34675334-34675356 TAGTAGGGTGTAGAGGAAGAAGG + Intronic
1173489791 20:43470495-43470517 GAATAATGAGTAGAGGAAGAAGG + Intergenic
1175120114 20:56710680-56710702 GGGGAGTGGGAAGAGGAAGAGGG - Intergenic
1175683197 20:61006369-61006391 GTGCAGTGAGCAGATGAAGAGGG + Intergenic
1178291678 21:31373873-31373895 GAGGAGTGGGGAGAGGAAGAGGG - Intronic
1179025064 21:37673184-37673206 GAGCAGAGGCTGGAGGAAGAGGG + Intronic
1180202048 21:46229757-46229779 CAGCAGAGGGAAGAGGAAGATGG + Intergenic
1180660014 22:17459050-17459072 GAGAAGTGCTTAGGGTAAGAAGG - Intronic
1181953714 22:26573110-26573132 GAGCAGTCCCTGGAGGAAGAAGG - Intronic
1183090461 22:35518784-35518806 GAGCAGAGAGCAGAGGAAAAGGG - Intergenic
1184355914 22:43979494-43979516 GAGCAGTGCTGAGAGGAGGAAGG - Intronic
1185355557 22:50367467-50367489 GAGCAGTGGGCAGAGGATGAGGG + Intronic
950264773 3:11565462-11565484 GAGCAGTACTGTGAGGAAGATGG - Intronic
953044806 3:39284841-39284863 AAGCAGTGGGTGGTGGAAGACGG + Intergenic
953507392 3:43499468-43499490 GAGCATTGAGCAGGGGAAGAGGG + Intronic
954367367 3:50153831-50153853 GAGAAGTGGGAGGAGGAAGAAGG + Intergenic
954551285 3:51483752-51483774 GAGCAGTGGGAAAAGGAACATGG - Exonic
962213107 3:133495840-133495862 GAGCAGGGCCTAGAGCAAAAAGG + Intergenic
962289104 3:134115757-134115779 GAGCTGTGGGGAGAGGAAAAAGG + Intronic
963106024 3:141647896-141647918 GAGAAGTCCCTCGAGGAAGAAGG - Intergenic
963434024 3:145244954-145244976 TACCAGTGTGTACAGGAAGATGG + Intergenic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
965145556 3:164897480-164897502 GAGAGGTGGGTAGAGAAAGATGG + Intergenic
965850867 3:173021211-173021233 CAGCAGAAAGTAGAGGAAGACGG + Intronic
966382235 3:179355622-179355644 CAGCACTGGGGAGAGGAAGAGGG + Intronic
966875567 3:184319882-184319904 GAGCAGTGACTTGAGGAGGAAGG + Intronic
966950400 3:184812101-184812123 GAGCAGTGCGAGGAGGAAAGCGG + Intergenic
967266822 3:187698775-187698797 GAGCAGTGCTACGAGGAGGATGG - Exonic
967703726 3:192624451-192624473 GAGCAGAGAGAAGAGGAGGAAGG + Intronic
968006469 3:195246592-195246614 GAGCAGTGAGCAGAGGCAGAGGG + Intronic
968665066 4:1816494-1816516 GGGCTGTGGGAAGAGGAAGAGGG + Intronic
969198755 4:5584884-5584906 GAGCAGTGAGTAGAGGAGGGTGG + Intronic
969606143 4:8203174-8203196 GAGCAGTGCGGGGAGGGAGGAGG + Intronic
974441411 4:61923128-61923150 AAGCAGTGGGTTGAGGGAGAAGG + Intronic
976043406 4:80915056-80915078 AAGCAGTGCTTAGGGGAAAACGG - Intronic
980081348 4:128347722-128347744 GAGCTGTGGGTAGGGGAGGATGG - Intergenic
980140661 4:128912711-128912733 GAGGAGGGCGAAGAGGAGGAGGG - Intronic
984713576 4:182905596-182905618 GAGCAGTGCTTTAAGAAAGAAGG - Intronic
985005060 4:185526120-185526142 GAGCAGGGCATGGAGGAAGATGG + Intronic
986344609 5:6823022-6823044 GAGCAGCGCGTAGAGGGTGAGGG - Intergenic
987416945 5:17671537-17671559 GAGAAGTGCGAAGAGTGAGAGGG - Intergenic
987797246 5:22644059-22644081 GAGCACCGAGGAGAGGAAGAAGG - Intronic
988012237 5:25503888-25503910 AAGCAGCGCTTAGAGGAAAATGG - Intergenic
988556330 5:32239190-32239212 CAGCAGTGCAAAGAGGAAGGAGG + Intronic
988785591 5:34563412-34563434 GACCAGGGCGGAGAGGAAGGCGG - Intergenic
989272432 5:39549021-39549043 GTGCAGTGCTTTGAGGAAGATGG + Intergenic
989296799 5:39837999-39838021 GAGGAATGGGTAGAGGGAGATGG - Intergenic
990399458 5:55423484-55423506 GGGCAGTGAGTAGAGGAGTAGGG + Intronic
992542795 5:77781138-77781160 GAGCAAAGCCCAGAGGAAGATGG - Intronic
993379158 5:87186208-87186230 TACCAGTGAGTGGAGGAAGAAGG - Intergenic
995636913 5:114203105-114203127 GAGCAGTGAATAGAGGATGGAGG + Intergenic
996209773 5:120793478-120793500 AAGCACTGCAAAGAGGAAGAAGG + Intergenic
996605207 5:125313413-125313435 GGGCACTGCCTAGTGGAAGAGGG - Intergenic
997691251 5:135828913-135828935 GAGAAGTGTGCAGAGGCAGAGGG - Intergenic
999886521 5:155929747-155929769 GAGCAGTGAGTAGGGGTAAATGG - Intronic
1000204970 5:159050250-159050272 GAGCAATGCAGAGAGGGAGAGGG - Intronic
1000847584 5:166300649-166300671 GAGAAATGAGTAGAAGAAGATGG - Intergenic
1001517989 5:172370138-172370160 GAGCCTTGTGTAGAGGAGGAAGG - Intronic
1001650177 5:173310461-173310483 GGGCAGTGAGGAGAGGGAGATGG - Intergenic
1001944941 5:175770938-175770960 GAGCTGTGGCCAGAGGAAGAGGG - Intergenic
1002361432 5:178674455-178674477 GAGGAATGCAAAGAGGAAGAAGG + Intergenic
1002663298 5:180805113-180805135 GAGCAGTGACTGGAGTAAGAAGG + Intronic
1003840503 6:10114279-10114301 GAGCAGGGGGTACAGGAGGAGGG - Intronic
1005385379 6:25279862-25279884 GAGGAGTACGCAGAGGAAGGTGG - Intronic
1005495400 6:26383561-26383583 GAGAAGTGGGAAGAGGAAGGAGG + Intronic
1005838252 6:29723801-29723823 GAGCCGTGGGTGGAGCAAGAGGG + Exonic
1005923710 6:30422516-30422538 TAGCAGTCTGTGGAGGAAGATGG - Intergenic
1008351754 6:50499632-50499654 CAGCAGTGTGCAGAGGAAGGGGG - Intergenic
1008657128 6:53627468-53627490 AAACAGTGGGTAGAGGATGAAGG - Intergenic
1010656818 6:78521223-78521245 AAGCAGTGAATGGAGGAAGAAGG + Intergenic
1010798443 6:80145779-80145801 GACCAGTGGGTACAGGAAGTAGG + Intronic
1013176485 6:107681912-107681934 GAACAAAGAGTAGAGGAAGAAGG - Intergenic
1015942103 6:138462933-138462955 GATGAGTGTGTAGATGAAGAGGG + Intronic
1016339071 6:143041681-143041703 GAGTAGTGAGCATAGGAAGAAGG - Intergenic
1016575720 6:145567856-145567878 GTGCAGTGCCTAGAATAAGATGG + Intronic
1017654803 6:156617438-156617460 GGGCAGTGAGCAGCGGAAGATGG - Intergenic
1017846206 6:158260710-158260732 GAGCAGTGAGTAGAGGATGAGGG + Intronic
1018604795 6:165585515-165585537 GAGAAGTGCACAGAGGAAAAGGG + Intronic
1020097192 7:5375810-5375832 GAGCTGTGAGCAGAGGCAGATGG - Intronic
1020788262 7:12594690-12594712 GAGGTGAGGGTAGAGGAAGAAGG + Intronic
1021365601 7:19773687-19773709 GAGCAGTGAGCAAAGAAAGACGG + Intergenic
1023795207 7:43786778-43786800 GAGCAGTGGGCACAGGAAGAGGG + Intronic
1026016824 7:66678186-66678208 GAGAATTGCCTTGAGGAAGAAGG - Intronic
1026910966 7:74091782-74091804 GAGCAGTGTTTAGAGGATGTCGG + Intronic
1027224774 7:76236855-76236877 GAGCTGTGGGTACCGGAAGAGGG + Intronic
1028728085 7:94111975-94111997 GAGAAGTGCCTAGAGAAAGGAGG - Intergenic
1031214807 7:118877126-118877148 GAGGAGGGGGAAGAGGAAGAAGG + Intergenic
1034503751 7:151468835-151468857 AAGCAGTGTGTAGAGAAAAAAGG + Intronic
1034744763 7:153513991-153514013 GAGCAGTGTGGAGAAGAGGAAGG + Intergenic
1036098320 8:5749803-5749825 TCCCAGTGGGTAGAGGAAGATGG + Intergenic
1037330907 8:17742598-17742620 GAGGCGTGAGTGGAGGAAGAGGG - Intronic
1039850916 8:41364292-41364314 CAGCTGTGCCTAGAGGCAGAGGG + Intergenic
1041698460 8:60762185-60762207 GAGCAGTAGTTAGAGGAAGATGG - Intronic
1045098016 8:98818214-98818236 AAGTAGTGTGTAGAGAAAGATGG - Intronic
1047320824 8:123780949-123780971 GAGAAGTAGGTAAAGGAAGAAGG - Intronic
1047403211 8:124563044-124563066 GAGCAGTGGTAAGAGGAAGGAGG + Intronic
1047937596 8:129797731-129797753 GAGCAGTGGGAAGAGAGAGAAGG + Intergenic
1048177906 8:132169644-132169666 GATCAGTGGGTTGAGGAAGTGGG - Intronic
1050264932 9:3879999-3880021 CAGCAGTGAGAAGAGGAAGAAGG - Intronic
1050611274 9:7356346-7356368 GGGAAGTGAGTAGAGGAAGCTGG - Intergenic
1051518632 9:17959373-17959395 AAGCTGTGGGTAGAGGAAGGAGG - Intergenic
1054720502 9:68598734-68598756 GAGGAGGGGGTAGGGGAAGAAGG + Intergenic
1056773152 9:89494277-89494299 GAGGAGAGGGAAGAGGAAGAGGG - Intronic
1056779362 9:89538045-89538067 GAGCAGTGTGTACAGGGAGTGGG - Intergenic
1056909887 9:90689251-90689273 AAGCAGTGTGTAGAGGCAAATGG + Intergenic
1058583892 9:106486333-106486355 GTGAAGTGGGTAGAAGAAGAAGG + Intergenic
1058770597 9:108227504-108227526 GAGCAGGTGGTAGAGAAAGAAGG + Intergenic
1060554914 9:124503312-124503334 GAGCAGTCCGTAGTGGTAGCCGG + Exonic
1061282030 9:129602914-129602936 GAGGAGAGGGGAGAGGAAGAGGG + Intergenic
1061772267 9:132934996-132935018 GGCCAGTGGTTAGAGGAAGATGG - Intronic
1061909062 9:133713241-133713263 GAGCAGGGCCTAGAGGAGGGAGG - Intronic
1062552600 9:137096731-137096753 GAGCAGAGAGCAGAGGGAGAGGG + Intronic
1187457034 X:19450656-19450678 GGGCTGTGTGTAAAGGAAGAGGG - Intronic
1188032783 X:25282997-25283019 GAGCTGTGGGTAGGGGAGGATGG - Intergenic
1188087099 X:25913028-25913050 GAGCAGTGTGGAGATGAAGGAGG - Intergenic
1193244599 X:79213160-79213182 GAGCACTGCATGGGGGAAGATGG - Intergenic
1195021653 X:100834223-100834245 GAGAAGTACGCAGAGGAAGGGGG - Intronic
1196991747 X:121336724-121336746 GAGCAGAAAGAAGAGGAAGAAGG + Intergenic
1198330184 X:135615729-135615751 GAGAAATGGGTAGAGAAAGAAGG - Intergenic
1198336744 X:135673270-135673292 GAGAAATGGGTAGAGAAAGAAGG + Intergenic
1199542694 X:148974735-148974757 GAGCAGTGCAAAGAGAAAGATGG - Intronic
1200750690 Y:6941718-6941740 GAGCAGAGCTTATGGGAAGATGG + Intronic
1200751167 Y:6945367-6945389 GAGCAGGGCATGGAGGACGAGGG - Intronic
1202351588 Y:23997972-23997994 AAGCAGTGTGTAGAGAAAAACGG + Intergenic
1202519191 Y:25672147-25672169 AAGCAGTGTGTAGAGAAAAACGG - Intergenic