ID: 1064493812

View in Genome Browser
Species Human (GRCh38)
Location 10:15886881-15886903
Sequence ACTATTTCATACACGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064493812_1064493814 23 Left 1064493812 10:15886881-15886903 CCACAGCACGTGTATGAAATAGT No data
Right 1064493814 10:15886927-15886949 GACACCTAGAGCCATTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064493812 Original CRISPR ACTATTTCATACACGTGCTG TGG (reversed) Intergenic
No off target data available for this crispr