ID: 1064502454

View in Genome Browser
Species Human (GRCh38)
Location 10:15989070-15989092
Sequence CAGGGTAAACACCAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064502446_1064502454 15 Left 1064502446 10:15989032-15989054 CCAACCTGATAAGATATGGGAGT No data
Right 1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG No data
1064502448_1064502454 11 Left 1064502448 10:15989036-15989058 CCTGATAAGATATGGGAGTAGGA No data
Right 1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064502454 Original CRISPR CAGGGTAAACACCAGGAGGC AGG Intergenic
No off target data available for this crispr