ID: 1064506749

View in Genome Browser
Species Human (GRCh38)
Location 10:16039328-16039350
Sequence TTGTATTTTTAGTAGAGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 602883
Summary {0: 82079, 1: 170980, 2: 171502, 3: 107694, 4: 70628}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506749_1064506757 28 Left 1064506749 10:16039328-16039350 CCCCATCTCTACTAAAAATACAA 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
Right 1064506757 10:16039379-16039401 ACCTGTAATCCCAGCTACTCGGG 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
1064506749_1064506756 27 Left 1064506749 10:16039328-16039350 CCCCATCTCTACTAAAAATACAA 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506749 Original CRISPR TTGTATTTTTAGTAGAGATG GGG (reversed) Intergenic
Too many off-targets to display for this crispr