ID: 1064506750

View in Genome Browser
Species Human (GRCh38)
Location 10:16039329-16039351
Sequence TTTGTATTTTTAGTAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 618077
Summary {0: 86734, 1: 238723, 2: 156972, 3: 78020, 4: 57628}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506750_1064506759 30 Left 1064506750 10:16039329-16039351 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 1064506759 10:16039382-16039404 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1064506750_1064506756 26 Left 1064506750 10:16039329-16039351 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1064506750_1064506757 27 Left 1064506750 10:16039329-16039351 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 1064506757 10:16039379-16039401 ACCTGTAATCCCAGCTACTCGGG 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506750 Original CRISPR TTTGTATTTTTAGTAGAGAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr