ID: 1064506751

View in Genome Browser
Species Human (GRCh38)
Location 10:16039330-16039352
Sequence TTTTGTATTTTTAGTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 489276
Summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506751_1064506757 26 Left 1064506751 10:16039330-16039352 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1064506757 10:16039379-16039401 ACCTGTAATCCCAGCTACTCGGG 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
1064506751_1064506759 29 Left 1064506751 10:16039330-16039352 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1064506759 10:16039382-16039404 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1064506751_1064506756 25 Left 1064506751 10:16039330-16039352 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506751 Original CRISPR TTTTGTATTTTTAGTAGAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr