ID: 1064506753

View in Genome Browser
Species Human (GRCh38)
Location 10:16039358-16039380
Sequence GTGTGGGCTAATTACATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506753_1064506765 29 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG No data
1064506753_1064506766 30 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506766 10:16039411-16039433 CAGGAGGATCGCTTGAACCTGGG No data
1064506753_1064506761 7 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506761 10:16039388-16039410 CCCAGCTACTCGGGAGGCTGAGG No data
1064506753_1064506757 -2 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506757 10:16039379-16039401 ACCTGTAATCCCAGCTACTCGGG No data
1064506753_1064506763 11 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506763 10:16039392-16039414 GCTACTCGGGAGGCTGAGGCAGG No data
1064506753_1064506764 14 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506764 10:16039395-16039417 ACTCGGGAGGCTGAGGCAGGAGG No data
1064506753_1064506759 1 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506759 10:16039382-16039404 TGTAATCCCAGCTACTCGGGAGG No data
1064506753_1064506756 -3 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506753 Original CRISPR GTGTGGGCTAATTACATGCC TGG (reversed) Intergenic