ID: 1064506753

View in Genome Browser
Species Human (GRCh38)
Location 10:16039358-16039380
Sequence GTGTGGGCTAATTACATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506753_1064506756 -3 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1064506753_1064506761 7 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506761 10:16039388-16039410 CCCAGCTACTCGGGAGGCTGAGG 0: 97626
1: 275854
2: 227041
3: 130261
4: 162635
1064506753_1064506766 30 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506766 10:16039411-16039433 CAGGAGGATCGCTTGAACCTGGG 0: 425
1: 25512
2: 117129
3: 214192
4: 245544
1064506753_1064506759 1 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506759 10:16039382-16039404 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1064506753_1064506757 -2 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506757 10:16039379-16039401 ACCTGTAATCCCAGCTACTCGGG 0: 29735
1: 147997
2: 251626
3: 208111
4: 212677
1064506753_1064506765 29 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG 0: 660
1: 44104
2: 117764
3: 154638
4: 97659
1064506753_1064506763 11 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506763 10:16039392-16039414 GCTACTCGGGAGGCTGAGGCAGG 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
1064506753_1064506764 14 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506764 10:16039395-16039417 ACTCGGGAGGCTGAGGCAGGAGG 0: 2010
1: 13967
2: 27406
3: 79772
4: 139992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506753 Original CRISPR GTGTGGGCTAATTACATGCC TGG (reversed) Intergenic
No off target data available for this crispr