ID: 1064506756

View in Genome Browser
Species Human (GRCh38)
Location 10:16039378-16039400
Sequence CACCTGTAATCCCAGCTACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 794039
Summary {0: 27298, 1: 77225, 2: 165100, 3: 221696, 4: 302720}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506751_1064506756 25 Left 1064506751 10:16039330-16039352 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1064506750_1064506756 26 Left 1064506750 10:16039329-16039351 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1064506753_1064506756 -3 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1064506749_1064506756 27 Left 1064506749 10:16039328-16039350 CCCCATCTCTACTAAAAATACAA 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
Right 1064506756 10:16039378-16039400 CACCTGTAATCCCAGCTACTCGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506756 Original CRISPR CACCTGTAATCCCAGCTACT CGG Intergenic
Too many off-targets to display for this crispr