ID: 1064506759

View in Genome Browser
Species Human (GRCh38)
Location 10:16039382-16039404
Sequence TGTAATCCCAGCTACTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1116664
Summary {0: 44593, 1: 206846, 2: 252437, 3: 185282, 4: 427506}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506750_1064506759 30 Left 1064506750 10:16039329-16039351 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 1064506759 10:16039382-16039404 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1064506753_1064506759 1 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506759 10:16039382-16039404 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506
1064506751_1064506759 29 Left 1064506751 10:16039330-16039352 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1064506759 10:16039382-16039404 TGTAATCCCAGCTACTCGGGAGG 0: 44593
1: 206846
2: 252437
3: 185282
4: 427506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506759 Original CRISPR TGTAATCCCAGCTACTCGGG AGG Intergenic
Too many off-targets to display for this crispr