ID: 1064506763

View in Genome Browser
Species Human (GRCh38)
Location 10:16039392-16039414
Sequence GCTACTCGGGAGGCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 793706
Summary {0: 87862, 1: 235715, 2: 200111, 3: 128617, 4: 141401}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506754_1064506763 -5 Left 1064506754 10:16039374-16039396 CCCACACCTGTAATCCCAGCTAC 0: 147
1: 752
2: 2175
3: 4263
4: 5414
Right 1064506763 10:16039392-16039414 GCTACTCGGGAGGCTGAGGCAGG 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
1064506753_1064506763 11 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506763 10:16039392-16039414 GCTACTCGGGAGGCTGAGGCAGG 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401
1064506755_1064506763 -6 Left 1064506755 10:16039375-16039397 CCACACCTGTAATCCCAGCTACT 0: 219
1: 695
2: 1868
3: 3166
4: 4549
Right 1064506763 10:16039392-16039414 GCTACTCGGGAGGCTGAGGCAGG 0: 87862
1: 235715
2: 200111
3: 128617
4: 141401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506763 Original CRISPR GCTACTCGGGAGGCTGAGGC AGG Intergenic
Too many off-targets to display for this crispr