ID: 1064506764

View in Genome Browser
Species Human (GRCh38)
Location 10:16039395-16039417
Sequence ACTCGGGAGGCTGAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263147
Summary {0: 2010, 1: 13967, 2: 27406, 3: 79772, 4: 139992}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506753_1064506764 14 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506764 10:16039395-16039417 ACTCGGGAGGCTGAGGCAGGAGG 0: 2010
1: 13967
2: 27406
3: 79772
4: 139992
1064506758_1064506764 -8 Left 1064506758 10:16039380-16039402 CCTGTAATCCCAGCTACTCGGGA 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
Right 1064506764 10:16039395-16039417 ACTCGGGAGGCTGAGGCAGGAGG 0: 2010
1: 13967
2: 27406
3: 79772
4: 139992
1064506754_1064506764 -2 Left 1064506754 10:16039374-16039396 CCCACACCTGTAATCCCAGCTAC 0: 147
1: 752
2: 2175
3: 4263
4: 5414
Right 1064506764 10:16039395-16039417 ACTCGGGAGGCTGAGGCAGGAGG 0: 2010
1: 13967
2: 27406
3: 79772
4: 139992
1064506755_1064506764 -3 Left 1064506755 10:16039375-16039397 CCACACCTGTAATCCCAGCTACT 0: 219
1: 695
2: 1868
3: 3166
4: 4549
Right 1064506764 10:16039395-16039417 ACTCGGGAGGCTGAGGCAGGAGG 0: 2010
1: 13967
2: 27406
3: 79772
4: 139992

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506764 Original CRISPR ACTCGGGAGGCTGAGGCAGG AGG Intergenic
Too many off-targets to display for this crispr