ID: 1064506765

View in Genome Browser
Species Human (GRCh38)
Location 10:16039410-16039432
Sequence GCAGGAGGATCGCTTGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506754_1064506765 13 Left 1064506754 10:16039374-16039396 CCCACACCTGTAATCCCAGCTAC No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG No data
1064506758_1064506765 7 Left 1064506758 10:16039380-16039402 CCTGTAATCCCAGCTACTCGGGA No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG No data
1064506760_1064506765 -1 Left 1064506760 10:16039388-16039410 CCCAGCTACTCGGGAGGCTGAGG No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG No data
1064506755_1064506765 12 Left 1064506755 10:16039375-16039397 CCACACCTGTAATCCCAGCTACT No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG No data
1064506753_1064506765 29 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG No data
1064506762_1064506765 -2 Left 1064506762 10:16039389-16039411 CCAGCTACTCGGGAGGCTGAGGC No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506765 Original CRISPR GCAGGAGGATCGCTTGAACC TGG Intergenic