ID: 1064506765

View in Genome Browser
Species Human (GRCh38)
Location 10:16039410-16039432
Sequence GCAGGAGGATCGCTTGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414825
Summary {0: 660, 1: 44104, 2: 117764, 3: 154638, 4: 97659}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064506762_1064506765 -2 Left 1064506762 10:16039389-16039411 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG 0: 660
1: 44104
2: 117764
3: 154638
4: 97659
1064506754_1064506765 13 Left 1064506754 10:16039374-16039396 CCCACACCTGTAATCCCAGCTAC 0: 147
1: 752
2: 2175
3: 4263
4: 5414
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG 0: 660
1: 44104
2: 117764
3: 154638
4: 97659
1064506760_1064506765 -1 Left 1064506760 10:16039388-16039410 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG 0: 660
1: 44104
2: 117764
3: 154638
4: 97659
1064506755_1064506765 12 Left 1064506755 10:16039375-16039397 CCACACCTGTAATCCCAGCTACT 0: 219
1: 695
2: 1868
3: 3166
4: 4549
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG 0: 660
1: 44104
2: 117764
3: 154638
4: 97659
1064506758_1064506765 7 Left 1064506758 10:16039380-16039402 CCTGTAATCCCAGCTACTCGGGA 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG 0: 660
1: 44104
2: 117764
3: 154638
4: 97659
1064506753_1064506765 29 Left 1064506753 10:16039358-16039380 CCAGGCATGTAATTAGCCCACAC No data
Right 1064506765 10:16039410-16039432 GCAGGAGGATCGCTTGAACCTGG 0: 660
1: 44104
2: 117764
3: 154638
4: 97659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064506765 Original CRISPR GCAGGAGGATCGCTTGAACC TGG Intergenic
Too many off-targets to display for this crispr