ID: 1064516564

View in Genome Browser
Species Human (GRCh38)
Location 10:16155544-16155566
Sequence TAGGTCATCAGGAAGCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064516557_1064516564 20 Left 1064516557 10:16155501-16155523 CCAAACCAAATTACAAACAAATC No data
Right 1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG No data
1064516558_1064516564 15 Left 1064516558 10:16155506-16155528 CCAAATTACAAACAAATCTAATC No data
Right 1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064516564 Original CRISPR TAGGTCATCAGGAAGCCTGG GGG Intergenic
No off target data available for this crispr