ID: 1064517637

View in Genome Browser
Species Human (GRCh38)
Location 10:16168210-16168232
Sequence GCCACGTTACCGGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064517637_1064517643 21 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517643 10:16168254-16168276 GACTAGTTATCTGCAGAAGAGGG No data
1064517637_1064517642 20 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517642 10:16168253-16168275 AGACTAGTTATCTGCAGAAGAGG No data
1064517637_1064517641 -3 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517641 10:16168230-16168252 GGCAAGAGCTGTCACTCAAAAGG No data
1064517637_1064517645 26 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517645 10:16168259-16168281 GTTATCTGCAGAAGAGGGCAGGG No data
1064517637_1064517644 25 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064517637 Original CRISPR GCCACGTTACCGGGCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr