ID: 1064517639

View in Genome Browser
Species Human (GRCh38)
Location 10:16168219-16168241
Sequence ACAGCTCTTGCCACGTTACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064517639_1064517644 16 Left 1064517639 10:16168219-16168241 CCCGGTAACGTGGCAAGAGCTGT No data
Right 1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG No data
1064517639_1064517642 11 Left 1064517639 10:16168219-16168241 CCCGGTAACGTGGCAAGAGCTGT No data
Right 1064517642 10:16168253-16168275 AGACTAGTTATCTGCAGAAGAGG No data
1064517639_1064517643 12 Left 1064517639 10:16168219-16168241 CCCGGTAACGTGGCAAGAGCTGT No data
Right 1064517643 10:16168254-16168276 GACTAGTTATCTGCAGAAGAGGG No data
1064517639_1064517645 17 Left 1064517639 10:16168219-16168241 CCCGGTAACGTGGCAAGAGCTGT No data
Right 1064517645 10:16168259-16168281 GTTATCTGCAGAAGAGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064517639 Original CRISPR ACAGCTCTTGCCACGTTACC GGG (reversed) Intergenic
No off target data available for this crispr