ID: 1064517641

View in Genome Browser
Species Human (GRCh38)
Location 10:16168230-16168252
Sequence GGCAAGAGCTGTCACTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064517638_1064517641 -6 Left 1064517638 10:16168213-16168235 CCAAAGCCCGGTAACGTGGCAAG No data
Right 1064517641 10:16168230-16168252 GGCAAGAGCTGTCACTCAAAAGG No data
1064517633_1064517641 19 Left 1064517633 10:16168188-16168210 CCCATAGTCAAATGTTCAGTTTC 0: 60
1: 133
2: 160
3: 122
4: 259
Right 1064517641 10:16168230-16168252 GGCAAGAGCTGTCACTCAAAAGG No data
1064517634_1064517641 18 Left 1064517634 10:16168189-16168211 CCATAGTCAAATGTTCAGTTTCC 0: 53
1: 132
2: 165
3: 111
4: 311
Right 1064517641 10:16168230-16168252 GGCAAGAGCTGTCACTCAAAAGG No data
1064517637_1064517641 -3 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517641 10:16168230-16168252 GGCAAGAGCTGTCACTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064517641 Original CRISPR GGCAAGAGCTGTCACTCAAA AGG Intergenic
No off target data available for this crispr