ID: 1064517642

View in Genome Browser
Species Human (GRCh38)
Location 10:16168253-16168275
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064517639_1064517642 11 Left 1064517639 10:16168219-16168241 CCCGGTAACGTGGCAAGAGCTGT No data
Right 1064517642 10:16168253-16168275 AGACTAGTTATCTGCAGAAGAGG No data
1064517637_1064517642 20 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517642 10:16168253-16168275 AGACTAGTTATCTGCAGAAGAGG No data
1064517640_1064517642 10 Left 1064517640 10:16168220-16168242 CCGGTAACGTGGCAAGAGCTGTC No data
Right 1064517642 10:16168253-16168275 AGACTAGTTATCTGCAGAAGAGG No data
1064517638_1064517642 17 Left 1064517638 10:16168213-16168235 CCAAAGCCCGGTAACGTGGCAAG No data
Right 1064517642 10:16168253-16168275 AGACTAGTTATCTGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064517642 Original CRISPR AGACTAGTTATCTGCAGAAG AGG Intergenic
No off target data available for this crispr