ID: 1064517643

View in Genome Browser
Species Human (GRCh38)
Location 10:16168254-16168276
Sequence GACTAGTTATCTGCAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064517640_1064517643 11 Left 1064517640 10:16168220-16168242 CCGGTAACGTGGCAAGAGCTGTC No data
Right 1064517643 10:16168254-16168276 GACTAGTTATCTGCAGAAGAGGG No data
1064517637_1064517643 21 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517643 10:16168254-16168276 GACTAGTTATCTGCAGAAGAGGG No data
1064517638_1064517643 18 Left 1064517638 10:16168213-16168235 CCAAAGCCCGGTAACGTGGCAAG No data
Right 1064517643 10:16168254-16168276 GACTAGTTATCTGCAGAAGAGGG No data
1064517639_1064517643 12 Left 1064517639 10:16168219-16168241 CCCGGTAACGTGGCAAGAGCTGT No data
Right 1064517643 10:16168254-16168276 GACTAGTTATCTGCAGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064517643 Original CRISPR GACTAGTTATCTGCAGAAGA GGG Intergenic
No off target data available for this crispr