ID: 1064517644

View in Genome Browser
Species Human (GRCh38)
Location 10:16168258-16168280
Sequence AGTTATCTGCAGAAGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064517639_1064517644 16 Left 1064517639 10:16168219-16168241 CCCGGTAACGTGGCAAGAGCTGT No data
Right 1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG No data
1064517640_1064517644 15 Left 1064517640 10:16168220-16168242 CCGGTAACGTGGCAAGAGCTGTC No data
Right 1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG No data
1064517638_1064517644 22 Left 1064517638 10:16168213-16168235 CCAAAGCCCGGTAACGTGGCAAG No data
Right 1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG No data
1064517637_1064517644 25 Left 1064517637 10:16168210-16168232 CCACCAAAGCCCGGTAACGTGGC No data
Right 1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064517644 Original CRISPR AGTTATCTGCAGAAGAGGGC AGG Intergenic
No off target data available for this crispr