ID: 1064521849

View in Genome Browser
Species Human (GRCh38)
Location 10:16210794-16210816
Sequence CTTTGGGATCCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064521844_1064521849 -8 Left 1064521844 10:16210779-16210801 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1064521849 10:16210794-16210816 CTTTGGGATCCCAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064521849 Original CRISPR CTTTGGGATCCCAAGGTGGA AGG Intergenic
No off target data available for this crispr