ID: 1064528556

View in Genome Browser
Species Human (GRCh38)
Location 10:16283695-16283717
Sequence GTAGTTAACCAGGACTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064528556_1064528560 -3 Left 1064528556 10:16283695-16283717 CCACCTAAGTCCTGGTTAACTAC No data
Right 1064528560 10:16283715-16283737 TACCTTTTTTCTCAGAAGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 303
1064528556_1064528561 -2 Left 1064528556 10:16283695-16283717 CCACCTAAGTCCTGGTTAACTAC No data
Right 1064528561 10:16283716-16283738 ACCTTTTTTCTCAGAAGCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 245
1064528556_1064528563 7 Left 1064528556 10:16283695-16283717 CCACCTAAGTCCTGGTTAACTAC No data
Right 1064528563 10:16283725-16283747 CTCAGAAGCAGGGGCCGCTAAGG 0: 1
1: 0
2: 1
3: 11
4: 118
1064528556_1064528567 27 Left 1064528556 10:16283695-16283717 CCACCTAAGTCCTGGTTAACTAC No data
Right 1064528567 10:16283745-16283767 AGGGAGAGATGTGAAGGTCAAGG 0: 1
1: 0
2: 3
3: 52
4: 528
1064528556_1064528559 -4 Left 1064528556 10:16283695-16283717 CCACCTAAGTCCTGGTTAACTAC No data
Right 1064528559 10:16283714-16283736 CTACCTTTTTTCTCAGAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 230
1064528556_1064528566 21 Left 1064528556 10:16283695-16283717 CCACCTAAGTCCTGGTTAACTAC No data
Right 1064528566 10:16283739-16283761 CCGCTAAGGGAGAGATGTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 85
1064528556_1064528564 8 Left 1064528556 10:16283695-16283717 CCACCTAAGTCCTGGTTAACTAC No data
Right 1064528564 10:16283726-16283748 TCAGAAGCAGGGGCCGCTAAGGG 0: 1
1: 0
2: 1
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064528556 Original CRISPR GTAGTTAACCAGGACTTAGG TGG (reversed) Intergenic
No off target data available for this crispr