ID: 1064535224

View in Genome Browser
Species Human (GRCh38)
Location 10:16351235-16351257
Sequence CTGTCTCGGTGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064535224_1064535231 2 Left 1064535224 10:16351235-16351257 CCCTCCACCTGCCACCGAGACAG No data
Right 1064535231 10:16351260-16351282 TCTCACTCCGTTACCCAGGCTGG 0: 26
1: 2543
2: 60775
3: 147782
4: 224898
1064535224_1064535233 12 Left 1064535224 10:16351235-16351257 CCCTCCACCTGCCACCGAGACAG No data
Right 1064535233 10:16351270-16351292 TTACCCAGGCTGGAGTGCAGTGG 0: 4403
1: 157642
2: 283892
3: 217964
4: 112602
1064535224_1064535230 -2 Left 1064535224 10:16351235-16351257 CCCTCCACCTGCCACCGAGACAG No data
Right 1064535230 10:16351256-16351278 AGAGTCTCACTCCGTTACCCAGG 0: 8
1: 771
2: 20883
3: 81373
4: 158022

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064535224 Original CRISPR CTGTCTCGGTGGCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr