ID: 1064546863

View in Genome Browser
Species Human (GRCh38)
Location 10:16459386-16459408
Sequence TGGAGTAGCTACAGCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064546863_1064546870 26 Left 1064546863 10:16459386-16459408 CCAGCAGTGCTGTAGCTACTCCA No data
Right 1064546870 10:16459435-16459457 GGGGCCTTTGAGAAATCATAGGG No data
1064546863_1064546867 6 Left 1064546863 10:16459386-16459408 CCAGCAGTGCTGTAGCTACTCCA No data
Right 1064546867 10:16459415-16459437 TCTCTGTTTAAGGAATCAATGGG No data
1064546863_1064546869 25 Left 1064546863 10:16459386-16459408 CCAGCAGTGCTGTAGCTACTCCA No data
Right 1064546869 10:16459434-16459456 TGGGGCCTTTGAGAAATCATAGG No data
1064546863_1064546866 5 Left 1064546863 10:16459386-16459408 CCAGCAGTGCTGTAGCTACTCCA No data
Right 1064546866 10:16459414-16459436 GTCTCTGTTTAAGGAATCAATGG No data
1064546863_1064546864 -4 Left 1064546863 10:16459386-16459408 CCAGCAGTGCTGTAGCTACTCCA No data
Right 1064546864 10:16459405-16459427 TCCACATTTGTCTCTGTTTAAGG No data
1064546863_1064546868 7 Left 1064546863 10:16459386-16459408 CCAGCAGTGCTGTAGCTACTCCA No data
Right 1064546868 10:16459416-16459438 CTCTGTTTAAGGAATCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064546863 Original CRISPR TGGAGTAGCTACAGCACTGC TGG (reversed) Intronic
No off target data available for this crispr