ID: 1064548327

View in Genome Browser
Species Human (GRCh38)
Location 10:16473727-16473749
Sequence GAAGCTGCTGAAAGAGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064548326_1064548327 -1 Left 1064548326 10:16473705-16473727 CCTTAAAGATGCAGTTTGTCATG 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1064548327 10:16473727-16473749 GAAGCTGCTGAAAGAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064548327 Original CRISPR GAAGCTGCTGAAAGAGATAT TGG Intronic
No off target data available for this crispr