ID: 1064548543

View in Genome Browser
Species Human (GRCh38)
Location 10:16475461-16475483
Sequence CGAGTTGCAATGTAAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064548543_1064548548 22 Left 1064548543 10:16475461-16475483 CCAGATTCTTACATTGCAACTCG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1064548548 10:16475506-16475528 AGAAGCTGCTTCCAATGATATGG No data
1064548543_1064548549 23 Left 1064548543 10:16475461-16475483 CCAGATTCTTACATTGCAACTCG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1064548549 10:16475507-16475529 GAAGCTGCTTCCAATGATATGGG No data
1064548543_1064548547 -10 Left 1064548543 10:16475461-16475483 CCAGATTCTTACATTGCAACTCG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1064548547 10:16475474-16475496 TTGCAACTCGGGGTTTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064548543 Original CRISPR CGAGTTGCAATGTAAGAATC TGG (reversed) Intronic
905495563 1:38382882-38382904 GTAGTTGCAATGGAAAAATCAGG + Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1078251695 11:9621968-9621990 CAATTTGCAATATAAGATTCAGG + Intergenic
1086450705 11:86913659-86913681 AGAGTTGGAATTTAAGAGTCTGG - Intronic
1086880661 11:92149861-92149883 CAAGTTTTAATGGAAGAATCAGG + Intergenic
1088439771 11:109856936-109856958 AGAGTTGAAATGAAACAATCTGG - Intergenic
1094185423 12:27637169-27637191 CCAATTGGAATGTAAGCATCAGG + Intronic
1098509330 12:71292985-71293007 CCATTTGCTATGTAAGAAGCTGG + Intronic
1105301126 13:19135607-19135629 CAACTTGCAATGTAAGTCTCTGG + Intergenic
1106195640 13:27491841-27491863 GAAGTTTCAATGTATGAATCTGG - Intergenic
1106401173 13:29432571-29432593 CGAGTTGCTCTATAAGAATCTGG + Intronic
1110927466 13:81173048-81173070 TGAGGTTCAATGTAAGAATCAGG + Intergenic
1116758042 14:48973221-48973243 TGAGCTGCAGTGTAAGAAGCAGG + Intergenic
1119917486 14:78415585-78415607 CTAGTCACCATGTAAGAATCTGG - Intronic
1130025498 15:80267421-80267443 GGAGCTGCAATGTGACAATCAGG - Intergenic
1137550097 16:49431650-49431672 CGGGTTGCAATGAAAGGAACTGG + Intergenic
1138102895 16:54268716-54268738 CACTTTGCAATGGAAGAATCAGG - Intronic
1140218139 16:73024525-73024547 TGAGTTGCACTGAAAGGATCAGG + Intronic
1143331296 17:6137863-6137885 CCAGGTGCAATGTAGGAAACAGG + Intergenic
1143563153 17:7706956-7706978 CCAGCTGCAATGTGAGTATCAGG + Intronic
1143793597 17:9318005-9318027 CGAGTTCATATGTAAGAATTGGG - Intronic
1155181955 18:23355723-23355745 AGAATTGCTATGTAAAAATCAGG - Intronic
1158556715 18:58481096-58481118 TAAGTTGTAATGTAAGAATGAGG + Intergenic
1159293903 18:66456018-66456040 CGTGTAGTAATGTAAGATTCTGG - Intergenic
925678988 2:6396852-6396874 AGAGCTGCCATGTAAGAAGCAGG - Intergenic
931395815 2:61887587-61887609 CGAGTTGAAATAGAAAAATCTGG - Intronic
1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG + Intronic
1176046019 20:63093001-63093023 GGAGTGGAAATGTAAGAACCAGG - Intergenic
1182185259 22:28395072-28395094 TGAGTTTCAATTTAAAAATCTGG + Intronic
951964206 3:28364383-28364405 CAATTTGCAATGTAAAAATATGG - Intronic
956240569 3:67125720-67125742 TGAGTTCCAATGTCAGCATCAGG + Intergenic
958767333 3:98385217-98385239 CAAATTGCAATTTATGAATCTGG - Intergenic
962947876 3:140188445-140188467 CAAGGTGCAATGTAAGCATCAGG - Intronic
964450971 3:156812893-156812915 CCAGTTGCAATGCAAGACTGAGG + Intergenic
969965380 4:10988611-10988633 TGAGTTGCCATGTAAGCAGCTGG + Intergenic
978366546 4:107989312-107989334 TGAGTTACAATGCAAAAATCAGG - Intergenic
980272831 4:130608939-130608961 CCAGTTTGTATGTAAGAATCAGG - Intergenic
989690320 5:44135760-44135782 CAATTTGCAATGTAAAAATATGG - Intergenic
994079456 5:95690561-95690583 GGCTTTGCAATGGAAGAATCAGG + Intronic
1004036289 6:11927447-11927469 CAACTTGCAATGTAAAAATCTGG + Intergenic
1008559423 6:52709282-52709304 CGATGGGCAATGTAAAAATCTGG + Intergenic
1009492033 6:64303181-64303203 GCAGTTGCAATGTTAGAAGCCGG - Intronic
1018256659 6:161926702-161926724 CTAGTTGCAGTCTAAGAAACAGG + Intronic
1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG + Intergenic
1022743783 7:33149010-33149032 AGATTTGCAATGTATGAATGGGG + Intronic
1027926901 7:84476747-84476769 TCAGCTACAATGTAAGAATCTGG - Intronic
1036988357 8:13563214-13563236 CAAGTTGAAGTGTTAGAATCAGG - Intergenic
1037749508 8:21671853-21671875 CCAGAAGCAATGTAAGAATTAGG - Intergenic
1041117176 8:54551183-54551205 TGAGTTGCAGTGCAGGAATCAGG - Intergenic
1041599199 8:59695686-59695708 GTAGTTGAAATGTAACAATCTGG - Intergenic
1047860188 8:128957385-128957407 CCAGTTGTAAAGTAAGGATCTGG + Intergenic
1053368818 9:37543376-37543398 GGAGTTGCAATTCTAGAATCAGG + Intronic
1057190723 9:93085889-93085911 GGAGTTGCAATGTGAGCACCAGG + Intergenic
1057742252 9:97722039-97722061 TGGGTTACAAGGTAAGAATCAGG + Intergenic
1058125714 9:101192239-101192261 AGAGTTGCAATCTAAGTCTCAGG - Intronic
1058294509 9:103288623-103288645 TGAATAGCAATGCAAGAATCAGG + Intergenic
1059149073 9:111931296-111931318 CAAGTTGCAATGCAAAACTCTGG + Exonic
1193331353 X:80238615-80238637 TGCGTTGCAAGGGAAGAATCAGG - Intergenic
1194151048 X:90325528-90325550 GTAGTTCCAATGTAAGCATCTGG - Intergenic
1197665547 X:129219495-129219517 GGAGTTGCAATTGAAGAGTCTGG + Intergenic
1200497417 Y:3902282-3902304 GTAGTTCCAATGTAAGCATCTGG - Intergenic