ID: 1064548549

View in Genome Browser
Species Human (GRCh38)
Location 10:16475507-16475529
Sequence GAAGCTGCTTCCAATGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064548543_1064548549 23 Left 1064548543 10:16475461-16475483 CCAGATTCTTACATTGCAACTCG 0: 1
1: 0
2: 0
3: 4
4: 56
Right 1064548549 10:16475507-16475529 GAAGCTGCTTCCAATGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064548549 Original CRISPR GAAGCTGCTTCCAATGATAT GGG Intronic
No off target data available for this crispr