ID: 1064552515

View in Genome Browser
Species Human (GRCh38)
Location 10:16519246-16519268
Sequence CTAAGAATCTCTGAATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064552511_1064552515 15 Left 1064552511 10:16519208-16519230 CCTGCTTGAATGGTGCTTAACAG 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1064552515 10:16519246-16519268 CTAAGAATCTCTGAATGTCCAGG No data
1064552510_1064552515 21 Left 1064552510 10:16519202-16519224 CCGAATCCTGCTTGAATGGTGCT 0: 1
1: 1
2: 0
3: 12
4: 119
Right 1064552515 10:16519246-16519268 CTAAGAATCTCTGAATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064552515 Original CRISPR CTAAGAATCTCTGAATGTCC AGG Intronic
No off target data available for this crispr