ID: 1064552730

View in Genome Browser
Species Human (GRCh38)
Location 10:16520306-16520328
Sequence GACCCCCGCCTCTCCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 170}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1064552720_1064552730 13 Left 1064552720 10:16520270-16520292 CCCTCTCCAGGCCGCGGGGCGCC 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552723_1064552730 2 Left 1064552723 10:16520281-16520303 CCGCGGGGCGCCCTCCTGCGCGC 0: 1
1: 0
2: 0
3: 20
4: 166
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552714_1064552730 29 Left 1064552714 10:16520254-16520276 CCAGACTCCGGAACTGCCCTCTC 0: 1
1: 0
2: 0
3: 7
4: 183
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552721_1064552730 12 Left 1064552721 10:16520271-16520293 CCTCTCCAGGCCGCGGGGCGCCC 0: 1
1: 0
2: 2
3: 24
4: 250
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552725_1064552730 -9 Left 1064552725 10:16520292-16520314 CCTCCTGCGCGCACGACCCCCGC 0: 1
1: 0
2: 0
3: 19
4: 170
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552713_1064552730 30 Left 1064552713 10:16520253-16520275 CCCAGACTCCGGAACTGCCCTCT 0: 1
1: 1
2: 1
3: 12
4: 273
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552722_1064552730 7 Left 1064552722 10:16520276-16520298 CCAGGCCGCGGGGCGCCCTCCTG 0: 1
1: 0
2: 1
3: 24
4: 326
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552716_1064552730 22 Left 1064552716 10:16520261-16520283 CCGGAACTGCCCTCTCCAGGCCG 0: 1
1: 0
2: 0
3: 25
4: 200
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170
1064552724_1064552730 -8 Left 1064552724 10:16520291-16520313 CCCTCCTGCGCGCACGACCCCCG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG 0: 1
1: 0
2: 2
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1064552730 Original CRISPR GACCCCCGCCTCTCCAGGGT GGG Intronic
900214953 1:1476457-1476479 GACCCCCGATGCTCCTGGGTTGG - Intronic
900222164 1:1514811-1514833 GACCCCCGATGCTCCTGGGTTGG - Intronic
900409406 1:2506036-2506058 CACCCCAGCTTCTCTAGGGTAGG - Intergenic
900564497 1:3325697-3325719 GTCCCCAGCCTCTCCAGGTCTGG + Intronic
901022386 1:6261749-6261771 GACCCTGGCCTCTCCCGGCTGGG - Intergenic
901088213 1:6625047-6625069 CACCCGCGTCTCCCCAGGGTCGG - Intronic
901822992 1:11842174-11842196 GACCCCGGCCTCTCGAGGGCTGG + Exonic
902765544 1:18612334-18612356 AACCAAAGCCTCTCCAGGGTCGG - Intergenic
903888211 1:26553518-26553540 CACCCCAGCCTCCCCAGGGGAGG + Intronic
904260256 1:29283877-29283899 GACCTCTCCCTCCCCAGGGTGGG - Intronic
904324946 1:29722271-29722293 GACCCCTGCCTGCCCTGGGTTGG - Intergenic
904928427 1:34066660-34066682 GACCCCTGCCTCCCTAGGCTAGG - Intronic
907266114 1:53262421-53262443 GAGCCCTGCCTTTCCTGGGTTGG - Intronic
912430580 1:109626484-109626506 CACCCCCAGCTCTCCAGGCTGGG - Intronic
913987352 1:143576861-143576883 CATCTCCACCTCTCCAGGGTTGG - Intergenic
1064552730 10:16520306-16520328 GACCCCCGCCTCTCCAGGGTGGG + Intronic
1065178897 10:23105450-23105472 TACCCCCTGCTTTCCAGGGTAGG + Intronic
1071527063 10:86365141-86365163 GACCCGCACCCCTCCAGGGCGGG + Intronic
1073427893 10:103467157-103467179 GACTCCCTCTTCCCCAGGGTGGG + Intergenic
1076541799 10:131219619-131219641 GTCTCCCGCCTCCCCAGGGAAGG + Intronic
1077230068 11:1454779-1454801 GACCCCTCCCTCACGAGGGTGGG - Intronic
1077372284 11:2188730-2188752 GACGGGCGCCTCTCCAGGGAAGG + Intergenic
1078448614 11:11424001-11424023 GACCCCCACTTCTCCAGGCCTGG - Intronic
1083799261 11:65037010-65037032 TGCTCCTGCCTCTCCAGGGTTGG + Intronic
1083938292 11:65881762-65881784 GAGCCCAGCCTCTCTAGGCTTGG + Intronic
1087491022 11:98827506-98827528 GTCCTCAGCCTCTCCAGTGTTGG + Intergenic
1089075074 11:115731844-115731866 GACCCCTGCATGTCTAGGGTTGG + Intergenic
1089780857 11:120872404-120872426 GACACCGGCCCCTCCACGGTTGG - Intronic
1091573317 12:1710603-1710625 AACCCCCGACTCTTCAGAGTTGG + Intronic
1092860572 12:12716741-12716763 GCCCCCAGCCTCCCCAGGGATGG + Intronic
1093580821 12:20782624-20782646 AACCCCCGACTCTTCAGAGTTGG - Intergenic
1094474896 12:30833406-30833428 GACCTCTGCCTCTCCAGGTTTGG - Intergenic
1098024751 12:66189565-66189587 GGCCCCCTCCTTTCCTGGGTTGG + Intronic
1098123795 12:67269528-67269550 GGCCCACGCCTCGCCAGGGAGGG + Exonic
1103191420 12:119005207-119005229 GAATCCATCCTCTCCAGGGTTGG - Intronic
1105640031 13:22252700-22252722 GAGCCCCGCCCCTTCAGAGTTGG + Intergenic
1107306046 13:39020898-39020920 GAGCCCTTCCTCTCCATGGTAGG + Intronic
1107722882 13:43267398-43267420 GGCCCCAGCCCCTCCAGGGAAGG - Intronic
1112518860 13:100079031-100079053 AACCCCCGACTCTTCAGAGTTGG + Intergenic
1113464362 13:110503518-110503540 CAGCCCAGCCTCTCCAGGCTTGG + Intronic
1113551773 13:111198120-111198142 AACCCCCGACTCTTCAGAGTTGG - Intronic
1113834233 13:113318368-113318390 GAGCCCCACATATCCAGGGTGGG - Intronic
1114259288 14:21025553-21025575 GACCCCCGCCTCCTCAGCGGCGG - Intronic
1121098495 14:91233982-91234004 GACCCCTAACTCGCCAGGGTCGG - Exonic
1121235958 14:92391364-92391386 AACCCCAGGGTCTCCAGGGTGGG + Intronic
1121835506 14:97088652-97088674 AACCCTCGCCTCTCAAGGTTTGG - Intergenic
1122031534 14:98915960-98915982 GTCCCTCTCCTCTCCAGGGAAGG + Intergenic
1123587435 15:21772635-21772657 GGCCCCATCCTCTCCAGGGCAGG - Intergenic
1123624073 15:22215200-22215222 GGCCCCATCCTCTCCAGGGCAGG - Intergenic
1123932250 15:25177542-25177564 CACCCACCCTTCTCCAGGGTTGG - Intergenic
1124516342 15:30370086-30370108 GACCCCCATCTCTCCAGAGGTGG - Intronic
1124726576 15:32160645-32160667 GACCCCCATCTCTCCAGAGGTGG + Intronic
1125381705 15:39092913-39092935 GACCTCCTGCTCCCCAGGGTAGG - Intergenic
1125718604 15:41834423-41834445 GAGGCTGGCCTCTCCAGGGTGGG + Intronic
1127725290 15:61743752-61743774 GAGCCCCGCCCCTCCAGGACAGG + Intergenic
1128776083 15:70321680-70321702 GAGCCCTGGCTCTCCTGGGTAGG + Intergenic
1130378972 15:83355938-83355960 GACTCCAGCCTCTCCAGTCTTGG - Intergenic
1130551720 15:84893666-84893688 GACCCCCTCTTCTCCATGGTGGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133306315 16:4811882-4811904 GACCCACCTCTCTCCAGGGGAGG + Intronic
1133477666 16:6138946-6138968 GACTCCCTCCTCTTCAGTGTGGG - Intronic
1133838225 16:9385435-9385457 CACCCCCGCCTCTCCAAGTGTGG + Intergenic
1134204303 16:12224418-12224440 CACTCCCTCCTCTCCAGGCTGGG - Intronic
1134683653 16:16143936-16143958 GTCAGCTGCCTCTCCAGGGTAGG + Intergenic
1135339937 16:21636706-21636728 AACCCCCGACTCTTCAGAGTTGG - Intronic
1135586970 16:23678976-23678998 GACCCCGGCTTTCCCAGGGTCGG - Exonic
1135635949 16:24075779-24075801 GAAGCCAGCCTCACCAGGGTAGG - Intronic
1136240239 16:28938915-28938937 GGCCCCCTCCTCCCCAGGCTGGG - Exonic
1136392535 16:29974477-29974499 CACCCCCTCCCCTCCAGGGGAGG + Exonic
1138327769 16:56190625-56190647 CACCCTGGCCTCCCCAGGGTGGG + Intergenic
1141140957 16:81496702-81496724 GACCCCCGCCTCTACTGGGATGG - Intronic
1141899026 16:86978434-86978456 GTCCCCATCCTCTCCAGGCTGGG + Intergenic
1142345296 16:89550129-89550151 GACCCCGGCCTCTCCCTGGCTGG - Intronic
1142636422 17:1260334-1260356 CCCCCCCGCCTCTCCAGGAGTGG - Intergenic
1143467302 17:7146093-7146115 GACCCCGCCCTCTCCAGCGCAGG - Intergenic
1143637917 17:8176872-8176894 AACACCGGCCTCTCCAGGTTCGG - Intergenic
1144767468 17:17740393-17740415 GACCCCCAACTCTCCAGAGGTGG - Intronic
1146310246 17:31763062-31763084 AACCCCCGACTCTTCAGAGTTGG + Intergenic
1146524326 17:33553095-33553117 GGCCTCTGCCACTCCAGGGTAGG - Intronic
1146526593 17:33572301-33572323 CACCCCCCCCACCCCAGGGTAGG + Intronic
1147425764 17:40345284-40345306 TACCCCCGCCTCTCCCCGGGAGG + Intronic
1147597769 17:41727714-41727736 GGCCAGCGGCTCTCCAGGGTGGG + Intronic
1147672427 17:42184313-42184335 GGCCCCCGGGCCTCCAGGGTCGG - Exonic
1148366833 17:47061626-47061648 GACCCATGGCTCTCCAGGCTGGG + Intergenic
1151472602 17:74327217-74327239 GTCCCCTACCTCTCAAGGGTGGG + Intronic
1160184063 18:76660908-76660930 GTCCCCAGCCCCTCCAGGGCGGG - Intergenic
1160234880 18:77077994-77078016 TGCCCCGGCCTCTCCAGGGAGGG + Intronic
1160720799 19:596125-596147 GGTCCCCGTCTCTCCAGGGCTGG - Intronic
1161741623 19:6024406-6024428 GCCCCGCCCCTCTCCAGGCTGGG - Intronic
1161971682 19:7585002-7585024 CACCCCCTCCTCTCCAGTGTGGG - Intergenic
1162344685 19:10112360-10112382 CACCCCTGCCTCTGCAGGCTGGG - Intronic
1162773593 19:12965444-12965466 CACGCCCGCCCCTCCAGGCTTGG + Intronic
1162933535 19:13969008-13969030 CACCCCCGTCTCTGCAGGGCAGG - Intronic
1162957505 19:14107441-14107463 GACGCCCGTCTCACCGGGGTGGG + Intronic
1165738587 19:38192821-38192843 GACCCCAGCCTCCCCAGGGTTGG + Intronic
1167753455 19:51394891-51394913 GACCCCAGAATCTCCAGGGACGG - Intergenic
1168561698 19:57389981-57390003 CACTCCCGCCTCTCCGTGGTGGG - Exonic
927042277 2:19241418-19241440 GACCCCTGCCCCTCAAGGTTGGG - Intergenic
928114415 2:28536943-28536965 GTCCCCCGCCTCTCCAGGGACGG + Intronic
929889418 2:45906807-45906829 GCCCCAGGCCTCTGCAGGGTAGG - Intronic
930038236 2:47101243-47101265 AACCCCCGACTCTTCAGAGTTGG + Intronic
930198336 2:48530256-48530278 GGACCCCCCCTCTCCAGGGTGGG + Intronic
932777402 2:74536424-74536446 TACCCGGCCCTCTCCAGGGTGGG + Exonic
936399439 2:112154505-112154527 GACCTCCCACTCTCCAAGGTGGG - Intronic
937240967 2:120462441-120462463 GAACTCCGCCTCTCCATGCTGGG + Intergenic
937250577 2:120521313-120521335 GACAGCCGCAGCTCCAGGGTCGG - Intergenic
937482130 2:122272760-122272782 GACACCCACCTCCCCAGGGAGGG + Intergenic
941688795 2:168476679-168476701 GACCCCAGGCTCTCCAGCCTTGG - Intronic
947802170 2:232936466-232936488 GACCCCACCCTATCCAGAGTGGG - Intronic
1170393725 20:15903468-15903490 AACCCACCCCTCTCCAGGATAGG - Intronic
1175398682 20:58686319-58686341 GACCTCCCCCTCCCCAGGGCTGG - Intronic
1175608565 20:60331327-60331349 AACCCTGGCCTCCCCAGGGTGGG - Intergenic
1176049584 20:63110817-63110839 GCCACCTGCCTCTGCAGGGTGGG + Intergenic
1176378806 21:6101566-6101588 GACCCCCACCTCCCCAGCATGGG + Intergenic
1178081527 21:29071633-29071655 GACCTCGGCCTCCCCAGTGTTGG + Intronic
1179744668 21:43436671-43436693 GACCCCCACCTCCCCAGCATGGG - Intergenic
1180046747 21:45309904-45309926 GATCCCGGGCTCTCCAGGGCGGG - Intergenic
1182097750 22:27637515-27637537 GAGGCCAGCTTCTCCAGGGTGGG - Intergenic
1183951401 22:41354948-41354970 GACCCCCCGCTCTACAGGTTCGG + Intronic
1185319983 22:50196216-50196238 GACCCCAGCCCCTCCAGAGGTGG + Intronic
949293124 3:2488477-2488499 GATGTCCTCCTCTCCAGGGTTGG + Intronic
949449242 3:4166865-4166887 CACCCCCGACTCTTCAGAGTTGG - Intronic
950104284 3:10378497-10378519 CACCCCTGCCTGCCCAGGGTAGG + Intronic
950153770 3:10707787-10707809 GACCCCCGCCGGGCCAGGGCGGG - Intronic
952956976 3:38563486-38563508 GCCCCCCGACTCTCCAGGATTGG - Intronic
957571233 3:81949640-81949662 GACACCAGCCTGACCAGGGTGGG + Intergenic
961016729 3:123474130-123474152 GACCCTCGACTCTCCAGTGAAGG + Intergenic
961536774 3:127575536-127575558 GAGCCTGGCCTGTCCAGGGTGGG - Intronic
963696464 3:148571514-148571536 AACCCCCGGCTCTTCAGAGTTGG + Intergenic
964223002 3:154368012-154368034 AACCCCCGACCCTCCAGGGCTGG + Intronic
964358343 3:155870522-155870544 GAGCCCCTCCTCTCGAGGGCCGG + Exonic
965175518 3:165325282-165325304 AACCTCCGCCTCTCCAAGCTGGG - Intergenic
966801597 3:183769026-183769048 CACCCCCGGCTCTCCTGGTTTGG - Intronic
968521538 4:1036708-1036730 GGCCCCGGCCTCACCAGGGAAGG - Intergenic
968764272 4:2459880-2459902 GCCCCCAGCCTCTCCAGCCTGGG - Intronic
968972295 4:3802361-3802383 GACTCACGCTTCTCCAGGCTCGG - Intergenic
969493559 4:7513339-7513361 CAGCCCCACCTCTGCAGGGTTGG - Intronic
982050657 4:151498431-151498453 TACCCCAACATCTCCAGGGTAGG + Intronic
983970279 4:173863280-173863302 GATCCTCTCCTCTCAAGGGTGGG - Intergenic
983974381 4:173915339-173915361 GATTCTCTCCTCTCCAGGGTGGG - Intergenic
987149125 5:15021036-15021058 GACCCCCGCCAACCCAGGGCTGG + Intergenic
987929605 5:24387781-24387803 AACCCCCGACTCTTCAGAGTTGG + Intergenic
991054385 5:62306155-62306177 GCGCCCCGCCTCCCCAGCGTCGG + Intronic
992610556 5:78504806-78504828 GAACCCTGCCTCTGCAGGGCTGG - Intronic
997666276 5:135631935-135631957 GACCTCCCCCTCCCCTGGGTTGG - Intergenic
1000618732 5:163459691-163459713 AGCCCCCGCCTCTTCAGGGCAGG - Intronic
1002434423 5:179222068-179222090 AACCCCCGTCCCTGCAGGGTTGG - Intronic
1002644990 5:180648745-180648767 GAACCCCGCCTCTCCTGTGCAGG + Intronic
1006301352 6:33195013-33195035 GACCTCCACCTCACTAGGGTTGG + Exonic
1006474766 6:34246766-34246788 GACCCCAGGCTCTGAAGGGTGGG + Exonic
1007220777 6:40277093-40277115 GACCCCCACCTCTCCATGGCAGG - Intergenic
1011577945 6:88825272-88825294 AACCCCCTCCTCTTCAGTGTGGG - Intronic
1013888361 6:114998579-114998601 AACCCCCGGCCCTCCAGGCTGGG + Intergenic
1014297549 6:119638518-119638540 CACCCCCACCTGTCCAAGGTTGG - Intergenic
1014449291 6:121564989-121565011 GATCCACACATCTCCAGGGTGGG - Intergenic
1016958322 6:149648417-149648439 GACCCCCGATTTTCCAGGGCCGG - Intronic
1019478093 7:1253806-1253828 GACCTCCCCCTCTCCAGCTTGGG + Intergenic
1019524893 7:1476486-1476508 CACCACCGCCTCTCCCGGATGGG + Intronic
1024734992 7:52295567-52295589 AACCCCCGACTCTTCAGAGTTGG + Intergenic
1026963908 7:74427125-74427147 AACCCCCACCTCCCCAGGTTGGG - Intergenic
1027162784 7:75814522-75814544 CACCACTGCCTCTCCAGGCTGGG + Intronic
1030359369 7:108579416-108579438 GACCCCTCCCTCTGCAGGCTTGG + Intergenic
1030647723 7:112082037-112082059 TCCCCACGCCTCTCCAGCGTAGG - Intronic
1032737079 7:134702395-134702417 TACCCCTGCCACTCAAGGGTGGG + Intergenic
1034404835 7:150896427-150896449 GACCTGCCCCTCCCCAGGGTAGG + Intergenic
1035262772 7:157672164-157672186 GCCCCTCGCTTCTCCAGGGGGGG - Intronic
1035271313 7:157721742-157721764 GAAACCCGGCTCTCCAGGGCAGG - Intronic
1035642415 8:1194145-1194167 TTCCCCCGCCCCTCAAGGGTAGG - Intergenic
1038287324 8:26217103-26217125 CGCCCCCGCCTCCCCAGGATTGG - Intergenic
1038638496 8:29305727-29305749 AACCCCCGACTCTTCAGAGTTGG + Intergenic
1039693460 8:39884738-39884760 AACCCCCGACTCTTCAGAGTTGG - Intergenic
1047177172 8:122553014-122553036 CAACCCGTCCTCTCCAGGGTGGG - Intergenic
1048540175 8:135335020-135335042 GACCCCCACCTTTAAAGGGTAGG - Intergenic
1049238952 8:141526902-141526924 GTCCTCAGCATCTCCAGGGTGGG + Intergenic
1049762125 8:144336484-144336506 CTCCCCCGCCTGTCCAGGGGCGG - Intergenic
1059382124 9:113934839-113934861 GTCCCCAGCCTCTCCATGCTCGG - Intronic
1062286651 9:135776042-135776064 GACCCCCGAGTTTCCAGGGAGGG - Intronic
1189229045 X:39437728-39437750 GACCCCCACCTCTCAATGGGAGG + Intergenic
1189360097 X:40343634-40343656 GAGCCCTGCCTATTCAGGGTTGG + Intergenic
1189427021 X:40910722-40910744 GACCCCCCCCCCCCCAGTGTTGG - Intergenic
1199223882 X:145348987-145349009 GCCCCCTGACTCTCAAGGGTGGG - Intergenic